View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13760_low_11 (Length: 313)
Name: NF13760_low_11
Description: NF13760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13760_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 209 - 288
Target Start/End: Complemental strand, 9571087 - 9571002
Alignment:
| Q |
209 |
cacatcaacgctcacagattaccacca------atccatcgttttctagcagactcttgatacagcctatacagttacttacttac |
288 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9571087 |
cacatcaacgctcacagattaccaccaccaccaatccatcgttttctagcagactcttgatacagcctatacagttacttacttac |
9571002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 69 - 111
Target Start/End: Complemental strand, 9571227 - 9571185
Alignment:
| Q |
69 |
aagatatgcatttctttactgttatactataactaaaaattaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9571227 |
aagatatgcatttctttactgttatactataactaaaaattaa |
9571185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 70 - 107
Target Start/End: Complemental strand, 9563011 - 9562974
Alignment:
| Q |
70 |
agatatgcatttctttactgttatactataactaaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9563011 |
agatatgcatttctttactgttatactataactaaaaa |
9562974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University