View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13761_high_2 (Length: 454)
Name: NF13761_high_2
Description: NF13761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13761_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 4e-76; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 65 - 269
Target Start/End: Original strand, 4159653 - 4159857
Alignment:
| Q |
65 |
gaatttgatagagtaaacgatacctttcatattatgcagatacatcaagtttctacaaaaattaatcacatcaattttcatataatcacatctcaggtgc |
164 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||| | |||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4159653 |
gaatttgatagagtaaacaatacctttcatattatgcagatacatcaattttccataaaacttaatcacatcaattttcatataatcatatctcaggtgc |
4159752 |
T |
 |
| Q |
165 |
actataaggtctacacagtaatttttgaatattagtcagatgttaggttataagtaaatattcagccatactcgcaaaagctttacacaaagagggtgac |
264 |
Q |
| |
|
| ||||||| ||||||| |||||| |||||||||||||||| | ||||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
4159753 |
attataaggcctacacactaatttatgaatattagtcagatttcaggttataactaaatattcagccatactcgcagaagctttacacgaagagggtgac |
4159852 |
T |
 |
| Q |
265 |
cacaa |
269 |
Q |
| |
|
||||| |
|
|
| T |
4159853 |
cacaa |
4159857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 291 - 369
Target Start/End: Original strand, 4159950 - 4160026
Alignment:
| Q |
291 |
atgcaagcttttcatgtccgataacagcaacatatgcccaattaaatgagagaccataaatggtattggttttgaagat |
369 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4159950 |
atgcaagcttttcatgaccgataacagcaacatatgtccaattaaat--gagaccataaatggcattggttttgaagat |
4160026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 374 - 438
Target Start/End: Complemental strand, 3077418 - 3077356
Alignment:
| Q |
374 |
atcattagtgattcttagacataaataagtaagaagcccttctgcttccattgtatagatataag |
438 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
3077418 |
atcattagtgattcttagaagtagataagtaagaacccct--ttcttccattgtatagatataag |
3077356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University