View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13761_low_5 (Length: 326)
Name: NF13761_low_5
Description: NF13761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13761_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 167 - 309
Target Start/End: Complemental strand, 19063444 - 19063302
Alignment:
| Q |
167 |
atgagatattcctcatggaatctgcacnnnnnnntaatcaaacattaagagctctagagaaagagatatgtgaagtgcaattttggtggagtaatatatt |
266 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19063444 |
atgagatattcctcatggaatctgcacaaaaaaataatcaaacattaagagctctagagaaagagatatgttaagtgcaattttggtggagtaatatatt |
19063345 |
T |
 |
| Q |
267 |
cttcaataacataagcatgacatttatttgatggtgtgattat |
309 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19063344 |
cttcaataacatgtgcatgacatttatttgatggtgtgattat |
19063302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University