View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13762_low_2 (Length: 206)
Name: NF13762_low_2
Description: NF13762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13762_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 7583047 - 7583222
Alignment:
| Q |
17 |
cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7583047 |
cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgttgtaaaaaattaaaatgcttgccagatggtattagacacctcactgc |
7583146 |
T |
|
| Q |
117 |
acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactggaac |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7583147 |
acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactggaac |
7583222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 7098199 - 7098027
Alignment:
| Q |
17 |
cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgc |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| |||||||||| || ||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7098199 |
cagagaaaatatggggaggtctgcaatcacttcaatctatgaggatttcttattgtgaaagattaaaatgcttgccagatggtattagacacctcaccgc |
7098100 |
T |
|
| Q |
117 |
acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactgg |
189 |
Q |
| |
|
|||||||| ||||| ||||| ||||||||||| ||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
7098099 |
acttgattcgttgactattgttggatgcccaacattgacggagcgatgcaaggagggaacaggggaagactgg |
7098027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 13615645 - 13615473
Alignment:
| Q |
17 |
cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgc |
116 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| ||||| ||| |||| || ||| | |||||||||| || | || |||||||||||||||| ||| |
|
|
| T |
13615645 |
cagagaaattatggggaggtcggcaatcacttcaatctatggtgattaatcattgtcgtaaattaaaatgcctgtcggacggtattagacacctcattgc |
13615546 |
T |
|
| Q |
117 |
acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactgg |
189 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| ||||| | ||| ||||||| |||||||| ||||||||||| |
|
|
| T |
13615545 |
acttgattcgttgaatatttttggatgcccaacattgaagaagcgatgcaaggagggaacatgggaagactgg |
13615473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 74 - 182
Target Start/End: Complemental strand, 30202877 - 30202769
Alignment:
| Q |
74 |
aaagattaaaatgcttgccagatggtattagacacctcactgcacttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaaggg |
173 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| ||||||||||| ||| ||| || ||||||||||||| ||| | ||||||| |||| |
|
|
| T |
30202877 |
aaagattaaaatgcttgctagaaggtattagacacctcacttcacttgatttgctgacaattttcggttgcccaatattgaaggaacgatgcaaggaggg |
30202778 |
T |
|
| Q |
174 |
aacagggga |
182 |
Q |
| |
|
||||||||| |
|
|
| T |
30202777 |
aacagggga |
30202769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 17981727 - 17981555
Alignment:
| Q |
17 |
cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgc |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| ||| |||| | |||| | ||| ||||||||||| || |||||||||||||| ||||| |
|
|
| T |
17981727 |
cagagaaaatatggggaggtctgcaatcacttcaatctatggtgattgttgattgtaggaaattgaaatgcttgccggacggtattagacaccttactgc |
17981628 |
T |
|
| Q |
117 |
acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactgg |
189 |
Q |
| |
|
|||||||| || | |||| || |||||||| |||| | ||| |||||| ||||||| || ||||||||| |
|
|
| T |
17981627 |
acttgattcattaactattcgtgcatgcccaacattggagaagcgatgcaatgagggaaccggagaagactgg |
17981555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University