View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13762_low_2 (Length: 206)

Name: NF13762_low_2
Description: NF13762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13762_low_2
NF13762_low_2
[»] chr1 (2 HSPs)
chr1 (17-192)||(7583047-7583222)
chr1 (17-189)||(7098027-7098199)
[»] chr4 (1 HSPs)
chr4 (17-189)||(13615473-13615645)
[»] chr5 (2 HSPs)
chr5 (74-182)||(30202769-30202877)
chr5 (17-189)||(17981555-17981727)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 7583047 - 7583222
Alignment:
17 cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgc 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
7583047 cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgttgtaaaaaattaaaatgcttgccagatggtattagacacctcactgc 7583146  T
117 acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactggaac 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7583147 acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactggaac 7583222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 7098199 - 7098027
Alignment:
17 cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgc 116  Q
    |||||||||||||||||||| |||||||||| ||||| |||||||||| ||  ||| |||||||||||||||||||||||||||||||||||||||| ||    
7098199 cagagaaaatatggggaggtctgcaatcacttcaatctatgaggatttcttattgtgaaagattaaaatgcttgccagatggtattagacacctcaccgc 7098100  T
117 acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactgg 189  Q
    |||||||| ||||| ||||| ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||    
7098099 acttgattcgttgactattgttggatgcccaacattgacggagcgatgcaaggagggaacaggggaagactgg 7098027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 13615645 - 13615473
Alignment:
17 cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgc 116  Q
    |||||||| |||||||||||  ||||||||| ||||| |||  |||| ||   |||   | |||||||||| || | || |||||||||||||||| |||    
13615645 cagagaaattatggggaggtcggcaatcacttcaatctatggtgattaatcattgtcgtaaattaaaatgcctgtcggacggtattagacacctcattgc 13615546  T
117 acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactgg 189  Q
    |||||||| ||||||||||  ||||||||||| ||||| | ||| ||||||| |||||||| |||||||||||    
13615545 acttgattcgttgaatatttttggatgcccaacattgaagaagcgatgcaaggagggaacatgggaagactgg 13615473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 74 - 182
Target Start/End: Complemental strand, 30202877 - 30202769
Alignment:
74 aaagattaaaatgcttgccagatggtattagacacctcactgcacttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaaggg 173  Q
    |||||||||||||||||| ||| |||||||||||||||||| ||||||||||| |||  |||   || ||||||||||||| ||| | ||||||| ||||    
30202877 aaagattaaaatgcttgctagaaggtattagacacctcacttcacttgatttgctgacaattttcggttgcccaatattgaaggaacgatgcaaggaggg 30202778  T
174 aacagggga 182  Q
    |||||||||    
30202777 aacagggga 30202769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 17981727 - 17981555
Alignment:
17 cagagaaaatatggggaggtttgcaatcactacaatccatgaggatttattgctgtaaaagattaaaatgcttgccagatggtattagacacctcactgc 116  Q
    |||||||||||||||||||| |||||||||| ||||| |||  ||||  |   ||||  | ||| ||||||||||| || |||||||||||||| |||||    
17981727 cagagaaaatatggggaggtctgcaatcacttcaatctatggtgattgttgattgtaggaaattgaaatgcttgccggacggtattagacaccttactgc 17981628  T
117 acttgatttgttgaatattgctggatgcccaatattgacggagctatgcaagaagggaacaggggaagactgg 189  Q
    ||||||||  || | ||||  || |||||||| ||||  | ||| ||||||  ||||||| || |||||||||    
17981627 acttgattcattaactattcgtgcatgcccaacattggagaagcgatgcaatgagggaaccggagaagactgg 17981555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University