View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_high_149 (Length: 264)
Name: NF13763_high_149
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_high_149 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 52465646 - 52465902
Alignment:
| Q |
1 |
atagaggacatatttctataagctatctttatcaagtggtaaacatatttctagaagacttatgtttgttgatgtgtgtttctggataatgatttatcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52465646 |
atagaggacatatttctataagctatctttatcaagtggtaaacatattcctagaagacttatgtttgttgatgtgtgtttctggacaatgatttatcag |
52465745 |
T |
|
| Q |
101 |
caagtggctcgggtaaagggtgtcatagatcttgaggtcggtgatgaatactaacccgaca-ttttttttattttaggcatattaaccggac-----nnn |
194 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||| |
|
|
| T |
52465746 |
caagtggctcgggtaaagggtgtcgtagatcttgaggtcggtgatgaatactaaccggacatttttttttattttaggcatattaacc-gacattttttt |
52465844 |
T |
|
| Q |
195 |
nnnnnnnactaaccggacatcttgtatgtagctattctaaacagacttgcagaataat |
252 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52465845 |
tttttttactaaccggacatcttgtatgtaactattctaaacagacttgcagaataat |
52465902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University