View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_high_169 (Length: 236)
Name: NF13763_high_169
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_high_169 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 236
Target Start/End: Original strand, 40998026 - 40998252
Alignment:
| Q |
12 |
atcatcacaatgtgtcggtgcaacatttacaaaattcggtccaacttacttaactagctcaatcctggatttttactggtttaaacgattttagtttggt |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
40998026 |
atcatcacaatgtgtaggtgcaacatttacaaaattcggtccaacttacttaactagctcaatcgtggattttgactggtttaaacgattttagtttggt |
40998125 |
T |
|
| Q |
112 |
tttt-ctca-gttcttttgttaccttgctatcgtctatttatgtagaaaaagttacttttattacctctatagttttaacaattctactaaatgcataga |
209 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40998126 |
tttttctcaagttcttttgttaccttgctatcgtctatttatgtagaaaaagttatttttattacctctatagttttaacaattctactaaatgcataga |
40998225 |
T |
|
| Q |
210 |
catatcatcacttagattgatcaattc |
236 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
40998226 |
cagatcatcacttagattgatcaattc |
40998252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University