View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_high_178 (Length: 229)
Name: NF13763_high_178
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_high_178 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 3 - 213
Target Start/End: Complemental strand, 27371318 - 27371108
Alignment:
| Q |
3 |
ttatatgggattaggaggagaagttgttaaaccaagttgtcgcttaagatttgatacttatcgcttctataattcaacaattgagttagagtcactgtcc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27371318 |
ttatatgggattaggaggagaagttgttaaaccaagttgtcgcttaagatttgatacttatcgcttctacaattcaacaattgagttagagtcactgtcg |
27371219 |
T |
 |
| Q |
103 |
ctacaaccttcaccgtctctaccaccttcggcagtcaccaataacacttctttaggtttgtttacggcaccatagctaccacaattgattgaacatttta |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
27371218 |
ctacaaccttcaccgtctctaccaccttcggcagtcaccaataatacctctttaggtttgttttcggcaccatatctaccacaattgattcaacatttta |
27371119 |
T |
 |
| Q |
203 |
ctatgtattta |
213 |
Q |
| |
|
||||||||||| |
|
|
| T |
27371118 |
ctatgtattta |
27371108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University