View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_high_180 (Length: 227)
Name: NF13763_high_180
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_high_180 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 38602471 - 38602250
Alignment:
| Q |
1 |
ccaacatgatgtttcataatgcagatattgcagtgattggaagttgaagttcaattattgaagannnnnnnctttgattttctcaggtaaacccttcccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38602471 |
ccaacatgatgtttcataatgcagatattgcagtgattggaagttgaagttcaattgttgaagatttttttctttgattttctcaggtaaacccttcccc |
38602372 |
T |
|
| Q |
101 |
ccaattcatatagtagggaaaatagttatgtgtagtgtttgttttaggttttcatgcct-ttttgtttaacccccaattgtgtagtgtcataacttttgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38602371 |
ccaattcatatagtagggaaaatagttctgtgtagtgtttgttttaggttttcatgccttttttttttaacccccaattgtgtagtgtcataacttttgt |
38602272 |
T |
|
| Q |
200 |
gcataggtttaaacccaattta |
221 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
38602271 |
gcatatgtttaaacccaattta |
38602250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University