View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_high_197 (Length: 204)
Name: NF13763_high_197
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_high_197 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 92 - 185
Target Start/End: Original strand, 16496842 - 16496932
Alignment:
| Q |
92 |
ttaaattagttggattgaaatgtgacttatggatatcgagagtttagacaaaaaataattaagatgtcaaaatcaaacaaattgaagcaattaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
16496842 |
ttaaattagttggattgaaatgtgacttatggatatcgagagtttagacaaaa---aattatgacgtcaaaatcgaacaaattgaagcaattaa |
16496932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University