View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_high_83 (Length: 408)
Name: NF13763_high_83
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_high_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 47 - 250
Target Start/End: Original strand, 33499515 - 33499722
Alignment:
| Q |
47 |
aggcaaaacaagcttattaaccttattattaggtgaacctcttctataaatagtttggttaaaccttatatgt--ccttccctttgctatctacttcctc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33499515 |
aggcaaaacaagcttattaaccttattattaggtgaacctcttctataaatagtttggttaaaccttatatgtgtccttccctttgctatctacttcctc |
33499614 |
T |
|
| Q |
145 |
tcttacttgcttacatgcgtagtg--ctttctcttaatcttgtaacttattccaagcactctcatttttaccaaaccctaatttcacattgtatttatct |
242 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499615 |
tcttacttgcttacatgcgtagtgtgctttctcttaatcttgtaacttattccaagcactctcatttttaccaaaccctaatttcacattgtatttatct |
33499714 |
T |
|
| Q |
243 |
gattccca |
250 |
Q |
| |
|
|||||||| |
|
|
| T |
33499715 |
gattccca |
33499722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 297 - 390
Target Start/End: Original strand, 33499719 - 33499812
Alignment:
| Q |
297 |
cccaggatctccttcttattccttctcctttgtttatgttggtcttgacacgtcaaacctcaccttgcatacttcccaaaccgaagtccccagt |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499719 |
cccaggatctccttcttattccttctcctttgtttatgttggtcttgacacgtcaaacctcaccttgcatacttcccaaaccgaagtccccagt |
33499812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University