View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_107 (Length: 364)
Name: NF13763_low_107
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_107 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 65 - 351
Target Start/End: Original strand, 9450673 - 9450957
Alignment:
| Q |
65 |
tttttgtcggtaacgcttttgtcacttgagtgagttttgaatgcaactactagttatgatggaaaagtggctactaaatgcatgaaaaccagtctatata |
164 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9450673 |
tttttgtcggtaactcttttgtctcttgagtgagttttgaatgcaactattagttatgatggaaaagtggctactaaatgcatgaaaaccagtctatata |
9450772 |
T |
|
| Q |
165 |
acccatactcttaaacatttagaaggtacattagattatttagctttactttgtaattttgcaactttcatatattctctcaaagagagttctaacttca |
264 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9450773 |
acccatactcttaagcatttagaaggtacattagattatttagctttactttgtaattttgcaactttcatatattctctcaaagagagttctaacttca |
9450872 |
T |
|
| Q |
265 |
tcttgttcttgtacctttgctgatttttatgtaagtaagtttttgatannnnnnnnctatcttatgttatttgtttatgttgttttg |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9450873 |
tcttgttcttgtacctttgctgatttttatctaagtaagtttttgata--ttttttctatcttatgttatttgtttatgttgttttg |
9450957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 9450572 - 9450615
Alignment:
| Q |
21 |
agaggtgtgtgccacttatggtggtcaacatatcaccactcgag |
64 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
9450572 |
agaggtgtgtgccacttatggtagttaacatatcaccactcgag |
9450615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 21 - 61
Target Start/End: Complemental strand, 30237044 - 30237004
Alignment:
| Q |
21 |
agaggtgtgtgccacttatggtggtcaacatatcaccactc |
61 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30237044 |
agaggtgtgtgccacctatggtggtcaacatatcaccactc |
30237004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 61
Target Start/End: Complemental strand, 12404192 - 12404156
Alignment:
| Q |
25 |
gtgtgtgccacttatggtggtcaacatatcaccactc |
61 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
12404192 |
gtgtgtgccacctatggtggtcaacgtatcaccactc |
12404156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 21 - 68
Target Start/End: Original strand, 29827455 - 29827503
Alignment:
| Q |
21 |
agaggtgtgtgccact-tatggtggtcaacatatcaccactcgagtttt |
68 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
29827455 |
agaggtgtgtgccaccatatggtggtcaacgtatcaccactcgtgtttt |
29827503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University