View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_126 (Length: 319)
Name: NF13763_low_126
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_126 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 276
Target Start/End: Complemental strand, 8930766 - 8930508
Alignment:
| Q |
18 |
aggcctatgataagaaagcgccgcctgggtatgtgagaaatgtgttgcaggatccagaagcttcgactctttcacgttcaagtctgttcgaggttaagta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
8930766 |
aggcctatgataagaaagcgccgcctgggtatgtgagaaatgtgttgcaagatccagaagcttcgactcttgcacgttcaagtccgttcgaggttaagta |
8930667 |
T |
 |
| Q |
118 |
cactactgcatttagtgatgataatccaaatgcttgtacaatcatgtgagtaggaatttgttgctttgtaaaatatatgtcttgttagattgggtagtgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8930666 |
cactactgcatttagtgatgataatccaaatgcttgtacaatcatgtgagtaggaatttgttgctttgtaaaatatatgtcttgttagattgggtagtgt |
8930567 |
T |
 |
| Q |
218 |
aagtggttgttgataaaatttaaattttccttagtttcaatttctcaattatgtgtgat |
276 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
8930566 |
aagtggttgtttataaaatttaaattatccttagtttcaatttctcaataatgtgtgat |
8930508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 273 - 305
Target Start/End: Original strand, 31917405 - 31917437
Alignment:
| Q |
273 |
tgataaggaataatcttctttatgtttgttttc |
305 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
31917405 |
tgataatgaataatcttctttatgtttgttttc |
31917437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 273 - 305
Target Start/End: Complemental strand, 50376423 - 50376391
Alignment:
| Q |
273 |
tgataaggaataatcttctttatgtttgttttc |
305 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
50376423 |
tgataatgaataatcttctttatgtttgttttc |
50376391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University