View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_128 (Length: 317)
Name: NF13763_low_128
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_128 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 314
Target Start/End: Original strand, 51534205 - 51534514
Alignment:
| Q |
12 |
gaaatgaaggagattatggaagtggaatctggtgttacaactccaagtgctcttcttgatgatgatggcagaaccaaacgaactggtataatttctcttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51534205 |
gaaatgaaggagattatggaagtggaatctggtgttacaactccaagtgctcttcttgatgatgatggcagaaccaaacgaactggtataatttctcttc |
51534304 |
T |
|
| Q |
112 |
ctattctaactctaaatctctaattagtaatttctctatatattttctccatgcatttctcatgcttggtttttacaatctccttgttatttggttttta |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51534305 |
ctattctaactctaaatctctaattattaatttctc--tatattttctccatgcatttctcatgcttggtttttacaatctccttgttatttggttttta |
51534402 |
T |
|
| Q |
212 |
ccaactcgtaaatcatgcac---------nnnnnnnnnatctctatactctatccataaccacgtatgtacttggtccacttttgaccagatacagataa |
302 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51534403 |
ccaactcgtaaatcatgcacttttttttttttttttttgtctctatactctatccataacaaagtatgtatttggtccacttttgaccagatacagataa |
51534502 |
T |
|
| Q |
303 |
agttttgattat |
314 |
Q |
| |
|
||||||| |||| |
|
|
| T |
51534503 |
agttttgcttat |
51534514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University