View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_132 (Length: 307)
Name: NF13763_low_132
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_132 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 123 - 283
Target Start/End: Original strand, 784825 - 784985
Alignment:
| Q |
123 |
ctccccatcaagtgcaaaccatatttatattgttcacacatagttcaaccatctattataaccataaagtgcttgaaccataacataaatatttcacttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784825 |
ctccccatcaagtgcaaaccatatttatattgttcacacatagttcaaccatctattataaccataaagtgcttgaaccataacataaatatttcacttc |
784924 |
T |
|
| Q |
223 |
tcgatctcatgtcagatttctaaaacattattaatgcatcctttaccttatgaatgaacaa |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
784925 |
tcgatctcatgtcagatttctaaaacattattaatgtatcctttaccttatgaatgaacaa |
784985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 784715 - 784787
Alignment:
| Q |
13 |
tagattatactataatgatccgaaagaacttgattgaatcgagattgaacaacacatagttcaaccaagttaa |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784715 |
tagattatactataatgatccgaaagaacttgattgaatcgagattgaacaacacatagttcaaccaagttaa |
784787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University