View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_142 (Length: 290)
Name: NF13763_low_142
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_142 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 274
Target Start/End: Complemental strand, 8445108 - 8444852
Alignment:
| Q |
16 |
atatagacaatataactttatcaagatttaattaattttcttattatctattgactattgaagtgtcttattcacaagaataattttttattttatagag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445108 |
atatagacaatataactttatcaagatttaattaattttcttattatctattgactattgaagtgtcttattcacaagaataattttttattttatagag |
8445009 |
T |
 |
| Q |
116 |
gataatttatagcttttatttaaactcataaaagagtaataagatatacannnnnnngagaggaagagtatgatatacatgtttcataacaattttttct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8445008 |
gataatttatagcttttatttaaactcataaaagagtaa---gatatacatttttttgagaggaagagtatgataaacatgtttcataacaattttttct |
8444912 |
T |
 |
| Q |
216 |
tatagaattgtaacatttgttttacaag-ttacagcatattttggtagcttatcattttt |
274 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8444911 |
tatagaattataacatttgttttacaagtttacagcatattttggtagcttatcattttt |
8444852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University