View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_146 (Length: 282)
Name: NF13763_low_146
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_146 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 12699562 - 12699827
Alignment:
| Q |
1 |
atcaattacctgagcaactgtgttatgatatttcttgccaaagcttaaggttactctgtttccgaaggcttcaaagagtggaagcaaagctttgggaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12699562 |
atcaattacctgagcaactgtgttatgatatttcttgccaaagcttaaggttactgtgtttccaaaggcttcaaagagtggaagcaaggctttgggaatt |
12699661 |
T |
|
| Q |
101 |
ttcgctctatagctcatgtaaaagatgaaacactactagaaaatttacatttgacatcagggcattcacatcagtggagaaatacttgaagggaaagaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12699662 |
ttcgctctatagctcatgtaaaagatgaaacactactagaaaatttacatttgacatcagggctttcacatcagtggagaaatacttgaagggaaagaac |
12699761 |
T |
|
| Q |
201 |
tttggagaaggttttcacatcagctgaggaaatgcctaagaggaataatagatactaaatagtttt |
266 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12699762 |
tttggagaaggttttcacaccagctgaggaaatgcctaagaggaataatagatactaaatagtttt |
12699827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 198
Target Start/End: Original strand, 51741416 - 51741484
Alignment:
| Q |
130 |
acactactagaaaatttacatttgacatcagggcattcacatcagtggagaaatacttgaagggaaaga |
198 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||| | |||||| ||| || ||||| |
|
|
| T |
51741416 |
acactactagaaaaaagacatttgacatcagggttttcacatcagtgcaaaaatacatgagggtaaaga |
51741484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 131 - 196
Target Start/End: Original strand, 24167159 - 24167224
Alignment:
| Q |
131 |
cactactagaaaatttacatttgacatcagggcattcacatcagtggagaaatacttgaagggaaa |
196 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||| ||||||||||||||||||||| ||| |||||| |
|
|
| T |
24167159 |
cactactagaaaatatacatttaacaatagggatttcacatcagtggagaaatacatgaggggaaa |
24167224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 131 - 175
Target Start/End: Original strand, 31713445 - 31713489
Alignment:
| Q |
131 |
cactactagaaaatttacatttgacatcagggcattcacatcagt |
175 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
31713445 |
cactactagaaaatatacatttgacatcagggttttcacatcagt |
31713489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University