View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_150 (Length: 274)
Name: NF13763_low_150
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_150 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 75 - 257
Target Start/End: Original strand, 4676332 - 4676514
Alignment:
| Q |
75 |
ctcccccatttttaaagaaaaaactactgataacatttagaatatagatttacctggtttcgggcactggtcttattgaagggagatcgtggatcttcag |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4676332 |
ctcccccatttttaaagaaaaaactactgataacatttagaatatagatttacctggtttcgggcactggtcttactgaagggagatcgtggatcttcag |
4676431 |
T |
|
| Q |
175 |
aagtataaatggagtaccaaccttgatgcactttaggatcattaatattattgctattaccaaatactttaggagcagaaacc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676432 |
aagtataaatggagtaccaaccttgatgcactttaggatcattaatattattgctattaccaaatactttaggagcagaaacc |
4676514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University