View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_151 (Length: 274)
Name: NF13763_low_151
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_151 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 38196147 - 38196402
Alignment:
| Q |
1 |
agaatgtgcatgaacccaattgtttgagtaagtcatataagatgttgtaccttttccttggcaaagtcttgtcaaagatggtaaaaactgagtcaaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196147 |
agaatgtgcatgaacccaattgtttgagtaagtcatataagatgttgtaccttttctttggcaaagtcttgtcaaagatggtaaaaactgagtcaaattc |
38196246 |
T |
 |
| Q |
101 |
tcagaaagaatgtaaaggaaattaattcaagttgccaagggaaaaacattattgggatttgggaactagaatgcaacacgtcacttgaaaatcgtttgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196247 |
tcagaaagaatgtaaaggaaattaattcaagttgccaaggtaaaaacattattgggatttgggaactagaatgcaacacgtcacttgaaaatcgtttgaa |
38196346 |
T |
 |
| Q |
201 |
aaacacaaggtgtgtttcaactttggatttgcctaaacaaatttagaggtaattgt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196347 |
aaacacaaggtgtgtttcaactttggatttgcctaaacaaatttagaggtaattgt |
38196402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University