View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_158 (Length: 259)
Name: NF13763_low_158
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_158 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 34 - 156
Target Start/End: Original strand, 37113629 - 37113751
Alignment:
| Q |
34 |
agatgaaacggcagcgtcgagatcgaaattgtgactttcgagaaagaaaagcgcttcttgtttggttgaagaagtgatttcgatgaatgagttgattagt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37113629 |
agatgaaacggcagcgtcgagatcgaaattgtgactttcgagaaagaaaagcgcttcttgtttggttgaagaagtgatttcgatgaatgagttgattagt |
37113728 |
T |
 |
| Q |
134 |
gcggtggaatcgcttgatgaggg |
156 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37113729 |
gcggtggaatcgcttgatgaggg |
37113751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University