View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_162 (Length: 255)
Name: NF13763_low_162
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_162 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 6272015 - 6272259
Alignment:
| Q |
1 |
taatcaatatgtgggttgaaatccatgatattcatgaaacagaagcatatgcaattgtggttgagctttcaaacaagaatctcctcaccttagtggaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6272015 |
taatcaatatgtgggttgaaatccatgatattcatgaaacagaagcatatgcaattgtggttgagctttcaaacaagaatctcctcaccttagtggaaga |
6272114 |
T |
|
| Q |
101 |
ggcacggtatgcaagttcagnnnnnnntaaatgcattcgtgttttatgaattaatatccttgcttgatcattattataaaacccttttggcattttttac |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6272115 |
ggcacggtatgcaagttcagaaaaaaataaatgcattcgtgttttatgaattaatatccttgcttgatcattattataaaacccttttggcattttttac |
6272214 |
T |
|
| Q |
201 |
ttttcagtgctggtggtatgtatagcagttgctttgagatctctg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6272215 |
ttttcagtgctggtggtatgtatagcagttgctttgagatctctg |
6272259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 204 - 245
Target Start/End: Original strand, 6263547 - 6263588
Alignment:
| Q |
204 |
tcagtgctggtggtatgtatagcagttgctttgagatctctg |
245 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
6263547 |
tcagtgctggtggcatgtacagcagttgctttgagatctctg |
6263588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 111
Target Start/End: Original strand, 6263335 - 6263443
Alignment:
| Q |
3 |
atcaatatgtgggttgaaatccatgatattcatgaaacagaagcatatgcaattgtggttgagctttcaaacaagaatctcctcaccttagtggaagagg |
102 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| |||| | ||| || | ||| ||||| |||||||| || || || ||||| |||||||| ||| |||| | |
|
|
| T |
6263335 |
atcaatatgtgggttgaaattcatgacattgatgagaaagatgcttttgctattgttgttgagctctccaataaaaatcttctcaccttggtgaaagaag |
6263434 |
T |
|
| Q |
103 |
cacggtatg |
111 |
Q |
| |
|
| ||||||| |
|
|
| T |
6263435 |
cgcggtatg |
6263443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University