View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_164 (Length: 248)
Name: NF13763_low_164
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_164 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 2 - 226
Target Start/End: Original strand, 11069273 - 11069497
Alignment:
| Q |
2 |
tattgaaagggcaacaatttacatttgtgcccctaatagacctttgcaacctggaacatccacccactcaatttccacaaccaattctccactctcaaca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11069273 |
tattgaaagggcaacaatttacatttgtgcccctaatagacctttgcaacctggaacatccacccactcaatttccacaaccaattctccactctcaaca |
11069372 |
T |
 |
| Q |
102 |
tttctcaatcttagaatcatttcttgaaggacttttccatttttccaaatacaactgctctcttcagcaaggcagttagtcctatttgcttgaaccctct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11069373 |
tttctcaatcttagaatcatttcttgaaggacttttccatttttccaaatgcaactgctctcttcagcaaggcagttagtcctatttgcttgaaccctct |
11069472 |
T |
 |
| Q |
202 |
tgattgcacaaccatttggaagagt |
226 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
11069473 |
tgattgcacaaccatttggaagagt |
11069497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 95 - 196
Target Start/End: Complemental strand, 32873903 - 32873802
Alignment:
| Q |
95 |
ctcaacatttctcaatcttagaatcatttcttgaaggacttttccatttttccaaatacaactgctctcttcagcaaggcagttagtcctatttgcttga |
194 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||| | ||||||||||| | |||| | || || |||||||| || ||||| |||||| ||| || |||| |
|
|
| T |
32873903 |
ctcaacatttctcaatcttaaactcatctcttggacgacttttccatctctccatacgcagctactctcttcggctaggcaattagtcgtatctggttga |
32873804 |
T |
 |
| Q |
195 |
ac |
196 |
Q |
| |
|
|| |
|
|
| T |
32873803 |
ac |
32873802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University