View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_165 (Length: 248)
Name: NF13763_low_165
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_165 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 33 - 229
Target Start/End: Original strand, 34901171 - 34901367
Alignment:
| Q |
33 |
ttgggtaaaatcatcttgagattcataacaaattgcttgatgaactacaatatgtgtatcaattgttgcttcaagtacatcatccctaaatcaaatgaca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34901171 |
ttgggtaaaatcatcttgagattcataacaaattgcttgatgaactacaatatgtgtatcaattgttgcttcaagtacatcatccctaaatcaaatgaca |
34901270 |
T |
 |
| Q |
133 |
ttttcatcttaattaaccactgactgatcgaacattcgaccagcaaaatgtttttccatgtcaccattctctaaataaccatattgactattgtatc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34901271 |
ttttcatcttaattaaccactgactgatcaaacatttgaccataaaaatgtttttccatgtcaccattctctaaataaccatattgactattgtatc |
34901367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University