View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_167 (Length: 242)
Name: NF13763_low_167
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_167 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 6 - 242
Target Start/End: Original strand, 36295616 - 36295852
Alignment:
| Q |
6 |
gagatgaatttgctggcacctcaagtaattaacttaatctctattgctcaaataaattgaacattgtatgttttggatttagatctaattagcgtaagag |
105 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36295616 |
gagatgaattttctggcacctcaagtaattaacttaatctctattgctcaaataaattgaacattttatgttttggatttagatctaattagcgtaagag |
36295715 |
T |
 |
| Q |
106 |
attaattttgatatactgtcagtgttaaaaattgttagattgttgacaaatcacaaccactcgtatgtatgaatgaatttataagtgtttctaggtgaag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||| |
|
|
| T |
36295716 |
attaattttgatatactgtcagtgttaaaaattgttagattgttgacaaatcacaaccactcgtatgtatgaatgaatttataagtgtttatagttaaag |
36295815 |
T |
 |
| Q |
206 |
tcatacctttgcaatgatcagatggttctagttgttt |
242 |
Q |
| |
|
||| || ||| |||||||||||||||| ||||||||| |
|
|
| T |
36295816 |
tcaaacattttcaatgatcagatggttatagttgttt |
36295852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University