View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_169 (Length: 240)
Name: NF13763_low_169
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_169 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 9094805 - 9095018
Alignment:
| Q |
11 |
gagagagaagaacatgcacacacactttgctnnnnnnnnn-ggaaatttcaatgtcaaggtaaacaatttaaaattcaagcaaagtaaggtaggcaagta |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9094805 |
gagagaaaagaacatgcacacacactttgctaaaaaaaaaaggaaatttcaatgtcaaggtaaacaatttaaaattcaagcaaagtaaggtaggcaagta |
9094904 |
T |
 |
| Q |
110 |
aacgatttcaaagtttttgatttatatataagtaactttgcacttcataattgagtactccttcataattcatagtggagttgttattattgttaggctt |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9094905 |
aacgatttcaaagtttttaatttatatataagtaactttgcacttcataattgagtactccttcataattcatattggagttgttattattgttaggctt |
9095004 |
T |
 |
| Q |
210 |
cacatgggggaact |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9095005 |
cacatgggggaact |
9095018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University