View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_178 (Length: 236)
Name: NF13763_low_178
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_178 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 23 - 236
Target Start/End: Original strand, 23090817 - 23091026
Alignment:
| Q |
23 |
cttgcttaattatcatattttttgtttaattggcaatactcaataaatcaatcattaaaactttatgcttacgcacaaacccactgattggaagattatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23090817 |
cttgcttaattatcatattttttgtttaattggcaatactcaataaatcaatcattaaaactttatacttacgcacaaacccactgattggaagattatt |
23090916 |
T |
 |
| Q |
123 |
tttctaacattaaaaattaaaaatcgaactcgaccccccaagatatgatatatcgctatttcattttattttttattcnnnnnnnntatatatgatatac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
23090917 |
tttctaacattaaaaattaaaaatcgaactcgacatccc----tatgatataccgctattttattttattttttattcaaaaaaaaaatatatgatatac |
23091012 |
T |
 |
| Q |
223 |
cgcattttaaagcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23091013 |
cgcattttaaagcc |
23091026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 120
Target Start/End: Complemental strand, 54792159 - 54792119
Alignment:
| Q |
80 |
aaactttatgcttacgcacaaacccactgattggaagatta |
120 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
54792159 |
aaactttatgcttacgcactaacccactgataggaagatta |
54792119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University