View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_185 (Length: 229)
Name: NF13763_low_185
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_185 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 70 - 210
Target Start/End: Original strand, 40416139 - 40416279
Alignment:
| Q |
70 |
gcgtaaaaaacaatgtaaagactatggcagtcactaacaagttcatttgaattgggagatcgtgcaagctcactttcttgtgctggttcaacataagcag |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40416139 |
gcgtaaaaaacaatgtaaagactatggcagtcactaaccagttcatttgaattgggagatcgtgcaagctcactttcttgtgctggttcaacataagcag |
40416238 |
T |
|
| Q |
170 |
catttgtgctcataccaagagttattgaagccacattgtct |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40416239 |
catttgtgctcataccaagagttattgcagccacattgtct |
40416279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University