View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_187 (Length: 227)
Name: NF13763_low_187
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_187 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 41534513 - 41534294
Alignment:
| Q |
1 |
aaaaaatttcatcaccgaaattcaaaaacccattgcttccatgcttacaactttaacacaacacaagcatgtcacaaccattgaagcttagaacaaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41534513 |
aaaaaatttcatcaccgaaattcaaaaacccattgcttccatgcttgcaactttaacacaacacaagcatgtcacaaccattgaagcttagaacaaaaaa |
41534414 |
T |
|
| Q |
101 |
tataaaat----aaatgtgacacatgaaatgaaatcaactccacgttgtcaaaccagaataccatcatcaccaactaagca-----acctcacctcacga |
191 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
41534413 |
tataaaataaataaatgtgacacatgaaatgaaatcaactccacgttgtcaaaccagaataccatcatcaccaacgaagcaacctcacctcacctcacga |
41534314 |
T |
|
| Q |
192 |
ctttgattgaaagaaagaag |
211 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41534313 |
ctttgattgaaagaaagaag |
41534294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 122
Target Start/End: Complemental strand, 41538330 - 41538282
Alignment:
| Q |
74 |
acaaccattgaagcttagaacaaaaaatataaaataaatgtgacacatg |
122 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
41538330 |
acaaccactgaagcttaaaacaaaaaatataaaataaatgtgacccatg |
41538282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 7 - 71
Target Start/End: Complemental strand, 41542661 - 41542597
Alignment:
| Q |
7 |
tttcatcaccgaaattcaaaaacccattgcttccatgcttacaactttaacacaacacaagcatg |
71 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||||||||| || ||||||||||| |||||| ||||| |
|
|
| T |
41542661 |
tttcataacccaaattcaaaaacccaatgcttccatgtttgcaactttaacataacacatgcatg |
41542597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University