View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_191 (Length: 225)
Name: NF13763_low_191
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_191 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 27371397 - 27371603
Alignment:
| Q |
1 |
ggcatgcattgaacaagaccatatatggtgctaaaatctgtagtattcacaccatctgcctcgtatttgcgacgagagtcgccagatgcagcagctttgt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
27371397 |
ggcatgcattgaacaagaccgtatatggtgctaaaatctgtagtattcacaccatctgcctcatatttgcgacgagagtcgccagatgcag---ctttgt |
27371493 |
T |
 |
| Q |
101 |
ctgttagatttctcatcacaaaactaagtggttcaatgtacttgtccgttttagttgtagacgttctattaccaaaatattgtgtaggatcagtttccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| || |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
27371494 |
ctgttagatttctcatcacaaaactaagtggttcaatgtacttgtccgcttcagttgtagacattgtattactaaaatatcgtgtaggatcagtttccaa |
27371593 |
T |
 |
| Q |
201 |
gctcccaagt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
27371594 |
gctcccaagt |
27371603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University