View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_192 (Length: 222)
Name: NF13763_low_192
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_192 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 886960 - 886773
Alignment:
| Q |
17 |
aatattggcaatcaatcggttaacctttggcgatgaaaataaataaattttccatgttgaaaacttctgattccaacattaacacatgaacctcttgtag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
886960 |
aatattggcaatcaatcggttaacctttggcgatgaaaataaataaattttccatgttgaaaacttctgattccaacattaacacatgaacctcttgtag |
886861 |
T |
|
| Q |
117 |
gtaagagattcatatgaaattaagaacaattgatcctgattttgccacttgtaagctcctaattgaacgaaatgtgtttagctatata |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
886860 |
gtaagagattcatatgaaattaagaataattgatcctgattttgccacttgtaagctcctaattgaacgaaatgtgtttagctatata |
886773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University