View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13763_low_192 (Length: 222)

Name: NF13763_low_192
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13763_low_192
NF13763_low_192
[»] chr5 (1 HSPs)
chr5 (17-204)||(886773-886960)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 886960 - 886773
Alignment:
17 aatattggcaatcaatcggttaacctttggcgatgaaaataaataaattttccatgttgaaaacttctgattccaacattaacacatgaacctcttgtag 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
886960 aatattggcaatcaatcggttaacctttggcgatgaaaataaataaattttccatgttgaaaacttctgattccaacattaacacatgaacctcttgtag 886861  T
117 gtaagagattcatatgaaattaagaacaattgatcctgattttgccacttgtaagctcctaattgaacgaaatgtgtttagctatata 204  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
886860 gtaagagattcatatgaaattaagaataattgatcctgattttgccacttgtaagctcctaattgaacgaaatgtgtttagctatata 886773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University