View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_194 (Length: 221)
Name: NF13763_low_194
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_194 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 12 - 204
Target Start/End: Complemental strand, 41986464 - 41986272
Alignment:
| Q |
12 |
catcatcatcctatttcctctcaaaacacagtctcttactcatcaaaccaccaacgcaacaacaaaatctccgtccctggttgattagaattacccaaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986464 |
catcatcatcctatttcctctcaaaacacagtctcttactcatcaaaccaccaccacaacaacaaaatctccgtccctggttgattagaattacccaaaa |
41986365 |
T |
|
| Q |
112 |
ttcatgtggcgaaacacaactcttccatcccctccgcccatgtgagtatccttgcccttatgattttccttacgtgcttgacttcaacaaatt |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986364 |
ttcatgtggggaaacacaactcttccatccactccgcccatgtgagtatccttgcccttatgattttccttacgtgcttgacttcaacaaatt |
41986272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 80 - 147
Target Start/End: Original strand, 44688182 - 44688249
Alignment:
| Q |
80 |
ctccgtccctggttgattagaattacccaaaattcatgtggcgaaacacaactcttccatcccctccg |
147 |
Q |
| |
|
|||||||| |||||||||||||||||| |||| ||| | || ||||||||||||||||| || ||||| |
|
|
| T |
44688182 |
ctccgtccttggttgattagaattaccaaaaactcacgcggagaaacacaactcttccacccactccg |
44688249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University