View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_202 (Length: 209)
Name: NF13763_low_202
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_202 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 38561007 - 38561187
Alignment:
| Q |
13 |
gataatacttaaaacgagttaaatgttaaatagtttatgtttagatacaagagtactaaacaataaactttgccgtcatgacacctcaacactggtttag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38561007 |
gataatacttaaaacgagttaaatgttaaatagtttatgtttagatacaagtgtactaaacaataaactttgccgtcatgacacctcaacactggtttag |
38561106 |
T |
 |
| Q |
113 |
tccgaattagttgttatgggttcgatcatcgacgtccaatgtctctaaccctacataaacaataaacttcaatgtaaaaat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38561107 |
tccgaattagttgttatgggttcgatcatcgacgtccaatgtctctaaccctacataaacaataaacttcaatgtaaaaat |
38561187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University