View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_71 (Length: 441)
Name: NF13763_low_71
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_71 |
 |  |
|
| [»] scaffold0083 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 327; Significance: 0; HSPs: 18)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 19 - 423
Target Start/End: Original strand, 17432451 - 17432851
Alignment:
| Q |
19 |
atgcgggagctttagtgcaccgggttgccctttaaactttacaaccttgtatttattcctcatatcgatcatatattgctttgataccatcgatgaaact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17432451 |
atgcgggagctttagtgcaccgggttgccctttaaactttacaaccttgtatttattcctcatatcgatcatatattgctttgataccatcaatgaaact |
17432550 |
T |
 |
| Q |
119 |
ccacttataccgccatatatgnnnnnnnnnnnnnnnnnnnattacaagatattaccatttataatactaatcatctaaaagtatattatttaatccataa |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17432551 |
ccacttataccgccatatatgttttttttatttttt----attacaagatattaccatttataatactaattatctaaaagtatattatttaatccataa |
17432646 |
T |
 |
| Q |
219 |
aaaatgaagaactagtggaatgtctgaagtgttggtatggaagttcttctgccaccaataggtagaaaagtcccattactccagtgtgctctttggtgtt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17432647 |
aaaatgaagaactagtggaatgtctgaagtgttggtatggaagttcttctgccaccaataggtagaaaagtcccattactccagtgtggtctttggtgtt |
17432746 |
T |
 |
| Q |
319 |
gttgtagttagattctagagttaaaatttcaccatcatttatcttgacagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctca |
418 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17432747 |
ggtgtagttagattctagagttaaaatttcaccatcatttatcttgacagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctca |
17432846 |
T |
 |
| Q |
419 |
tttcc |
423 |
Q |
| |
|
||||| |
|
|
| T |
17432847 |
tttcc |
17432851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 200 - 434
Target Start/End: Original strand, 17453513 - 17453748
Alignment:
| Q |
200 |
tatattattta-atccataaaaaatgaagaactagtggaatgtctgaagtgttggtatggaagttcttctgccaccaataggtagaaaagtcccattact |
298 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17453513 |
tatattatttatatccataaaaaacgaagaacgagtggaatgtctgaagtgttggtatgggagttgttctgccaccaataggtagaaaagtcccattact |
17453612 |
T |
 |
| Q |
299 |
ccagtgtgctctttggtgttgttgtagttagattctagagttaaaatttcaccatcatttatcttgacagaacctggtttaggataacaagtagacattc |
398 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17453613 |
ccagtatgctctttggtgttgttgtagttagattcatgagttaaaatttcaccatcaattatcttgacagaacctggtttaggataacaagtagacattc |
17453712 |
T |
 |
| Q |
399 |
ctacaatgtaccctgcctcatttcctgcttcttttc |
434 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17453713 |
ctacaatgtaccctgcctcatttcctgcttcatttc |
17453748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 24 - 137
Target Start/End: Original strand, 17448425 - 17448538
Alignment:
| Q |
24 |
ggagctttagtgcaccgggttgccctttaaactttacaaccttgtatttattcctcatatcgatcatatattgctttgataccatcgatgaaactccact |
123 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17448425 |
ggagttttagttcaccgagttgccctttaaactttacaaccttgtatttattcctcatatcgatcatacattgctttgataccatcgatgaaactccact |
17448524 |
T |
 |
| Q |
124 |
tataccgccatata |
137 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
17448525 |
tataccaccatata |
17448538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 12892109 - 12892144
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12892109 |
catatgcgggagctttagtgcaccgggttgcccttt |
12892144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 6808497 - 6808530
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6808497 |
tatgcgggagctttagtgcaccgggttgcccttt |
6808530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 29355888 - 29355855
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29355888 |
tatgcgggagctttagtgcaccgggttgcccttt |
29355855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 1347062 - 1347097
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1347062 |
catatgcgggagctctagtgcaccgggttgcccttt |
1347097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 1354792 - 1354757
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1354792 |
catatgcgggagctctagtgcaccgggttgcccttt |
1354757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 25557823 - 25557858
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25557823 |
catatgcgggagctctagtgcaccgggttgcccttt |
25557858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 25997749 - 25997784
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25997749 |
catatgcgggagctctagtgcaccgggttgcccttt |
25997784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 26097258 - 26097293
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26097258 |
catatgcgggagctctagtgcaccgggttgcccttt |
26097293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 2166444 - 2166410
Alignment:
| Q |
17 |
atatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
2166444 |
atattcgggagctttagtgcaccgggttgcccttt |
2166410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 2178077 - 2178043
Alignment:
| Q |
17 |
atatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
2178077 |
atattcgggagctttagtgcaccgggttgcccttt |
2178043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 12886015 - 12886048
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
12886015 |
tatgtgggagctttagtgcaccgggttgcccttt |
12886048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 13267827 - 13267860
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
13267827 |
tatgcgggagcttcagtgcaccgggttgcccttt |
13267860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 23930160 - 23930127
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
23930160 |
tatgcgggagctttagtgcaccgagttgcccttt |
23930127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 47
Target Start/End: Complemental strand, 30786407 - 30786378
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcc |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30786407 |
tatgcgggagctttagtgcaccgggttgcc |
30786378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 345 - 434
Target Start/End: Original strand, 34210974 - 34211063
Alignment:
| Q |
345 |
tttcaccatcatttatcttgacagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctcatttcctgcttcttttc |
434 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||| |||||||| |||||| || |||| ||| ||| ||||||| ||||||||||||| |
|
|
| T |
34210974 |
tttcaccatcatcaatcttcattgaacctggttttggataacatacagacatcccaacaaggtaaccttcctcattccctgcttcttttc |
34211063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 171; Significance: 1e-91; HSPs: 37)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 184 - 429
Target Start/End: Original strand, 38237089 - 38237335
Alignment:
| Q |
184 |
actaatcatctaaaagtatattattta-atccataaaaaatgaagaactagtggaatgtctgaagtgttggtatggaagttcttctgccaccaataggta |
282 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
38237089 |
actaattatctaaaagtatattatttatatccataaaaaatgaagaacgagtagaatgtctgaagtgttggtatgggagctgttctgccaccaataggta |
38237188 |
T |
 |
| Q |
283 |
gaaaagtcccattactccagtgtgctctttggtgttgttgtagttagattctagagttaaaatttcaccatcatttatcttgacagaacctggtttagga |
382 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| ||||||||||||| |||||||||||| ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
38237189 |
gaaaagtcccattactccggtgtgctccttggtgctgttgtagttagactctagagttaaagtttcaccatcaataatcttgacagaacctggtttagga |
38237288 |
T |
 |
| Q |
383 |
taacaagtagacattcctacaatgtaccctgcctcatttcctgcttc |
429 |
Q |
| |
|
|||||||| ||||||||||||||||| || || |||||||||||||| |
|
|
| T |
38237289 |
taacaagtggacattcctacaatgtatcccgcttcatttcctgcttc |
38237335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 185 - 434
Target Start/End: Original strand, 38213186 - 38213436
Alignment:
| Q |
185 |
ctaatcatctaaaagtatattattta-atccataaaaaatgaagaactagtggaatgtctgaagtgttggtatggaagttcttctgccaccaataggtag |
283 |
Q |
| |
|
||||| ||||||||| |||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||| |||| |||||||||||||| |||| |
|
|
| T |
38213186 |
ctaattatctaaaagcatattatttatatccataaaaaatgaagaacgagtagaatgtctgaagtgttggtatgggagttgttctgccaccaataagtag |
38213285 |
T |
 |
| Q |
284 |
aaaagtcccattactccagtgtgctctttggtgttgttgtagttagattctagagttaaaatttcaccatcatttatcttgacagaacctggtttaggat |
383 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| |||||||||| ||||||| ||| ||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
38213286 |
aaaagtcccattactccagtgtgctccttgctgttgctgtagttagacactagagtcaaagtttcaccatcaataatcttgacagaacctggtttaggat |
38213385 |
T |
 |
| Q |
384 |
aacaagtagacattcctacaatgtaccctgcctcatttcctgcttcttttc |
434 |
Q |
| |
|
|||| || |||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
38213386 |
aacatgtggacattcctacaatatagtttgcctcatttcctgcttcatttc |
38213436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 184 - 434
Target Start/End: Original strand, 38225670 - 38225921
Alignment:
| Q |
184 |
actaatcatctaaaagtatattattta-atccataaaaaatgaagaactagtggaatgtctgaagtgttggtatggaagttcttctgccaccaataggta |
282 |
Q |
| |
|
|||||| ||||||||| |||||||||| |||||||||||||||||||| ||| ||||||||||||||||| | ||| || | |||||||||||| | ||| |
|
|
| T |
38225670 |
actaattatctaaaagcatattatttatatccataaaaaatgaagaacgagtagaatgtctgaagtgttgatctgggagctgttctgccaccaacaagta |
38225769 |
T |
 |
| Q |
283 |
gaaaagtcccattactccagtgtgctctttggtgttgttgtagttagattctagagttaaaatttcaccatcatttatcttgacagaacctggtttagga |
382 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| || |||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38225770 |
gaaaagtcccattactccagtgtgctccttggtgctgctgtagttagacactagagttaaagtttcaccatcaactatcttgacagaacctggtttagga |
38225869 |
T |
 |
| Q |
383 |
taacaagtagacattcctacaatgtaccctgcctcatttcctgcttcttttc |
434 |
Q |
| |
|
||||| || ||||||||||||||||| |||| |||||| || ||||| |||| |
|
|
| T |
38225870 |
taacatgtggacattcctacaatgtagcctgtctcattcccagcttcatttc |
38225921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 248 - 434
Target Start/End: Original strand, 38247616 - 38247802
Alignment:
| Q |
248 |
tgttggtatggaagttcttctgccaccaataggtagaaaagtcccattactccagtgtgctctttggtgttgttgtagttagattctagagttaaaattt |
347 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||| |||||| ||| |
|
|
| T |
38247616 |
tgttggtatgggagttgttctgccaccaataggtagaaaagtcccattactccagtgtgctccctggtgctgttgtagttagactctagggttaaagttt |
38247715 |
T |
 |
| Q |
348 |
caccatcatttatcttgacagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctcatttcctgcttcttttc |
434 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||| || |||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
38247716 |
caccatcaataatcttgacagaacctggtttaggataacatgtggacattcctacaatataggttgcctcatttcctgcttcatttc |
38247802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 211 - 434
Target Start/End: Original strand, 38219611 - 38219834
Alignment:
| Q |
211 |
atccataaaaaatgaagaactagtggaatgtctgaagtgttggtatggaagttcttctgccaccaataggtagaaaagtcccattactccagtgtgctct |
310 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| | ||| |||| ||||||||||||||||||||||||||||||||| ||| |||| ||| |
|
|
| T |
38219611 |
atccataaaaaatgaagaacgggtagaatgtctgaagtgttgatctgggagttgttctgccaccaataggtagaaaagtcccattacaccattgtgttct |
38219710 |
T |
 |
| Q |
311 |
ttggtgttgttgtagttagattctagagttaaaatttcaccatcatttatcttgacagaacctggtttaggataacaagtagacattcctacaatgtacc |
410 |
Q |
| |
|
| | | ||||||||| |||| ||| ||||||| ||||||||||| | ||||||| ||||||||||||||||||||| || ||||||||||||||||| | |
|
|
| T |
38219711 |
tggctattgttgtagatagagactaaagttaaagtttcaccatcaataatcttgatagaacctggtttaggataacatgtggacattcctacaatgtagc |
38219810 |
T |
 |
| Q |
411 |
ctgcctcatttcctgcttcttttc |
434 |
Q |
| |
|
||| ||||||||| ||||| |||| |
|
|
| T |
38219811 |
ctgtctcatttccagcttcgtttc |
38219834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 248 - 429
Target Start/End: Original strand, 38252647 - 38252828
Alignment:
| Q |
248 |
tgttggtatggaagttcttctgccaccaataggtagaaaagtcccattactccagtgtgctctttggtgttgttgtagttagattctagagttaaaattt |
347 |
Q |
| |
|
||||| ||||| || | |||||||||||||| ||||||||| ||||||||||| |||||||| |||||| ||||||||||||| |||||||| ||| ||| |
|
|
| T |
38252647 |
tgttgatatgggagctgttctgccaccaatatgtagaaaagccccattactccggtgtgctccttggtgctgttgtagttagactctagagtcaaagttt |
38252746 |
T |
 |
| Q |
348 |
caccatcatttatcttgacagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctcatttcctgcttc |
429 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| || ||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
38252747 |
caccatcaattatcttaacagaacctggtttaggataacatgtggacattcctacaatgtagcctgattcatttcctgcttc |
38252828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 265 - 429
Target Start/End: Original strand, 38242371 - 38242535
Alignment:
| Q |
265 |
ttctgccaccaataggtagaaaagtcccattactccagtgtgctctttggtgttgttgtagttagattctagagttaaaatttcaccatcatttatcttg |
364 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||| |||| | | |||||||||||||| |||||||||||| ||||||||||| | |||||| |
|
|
| T |
38242371 |
ttctgccaccaataggtagaaaaatcccattacaccagtgtgttcttggctattgttgtagttagactctagagttaaagtttcaccatcaataatcttg |
38242470 |
T |
 |
| Q |
365 |
acagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctcatttcctgcttc |
429 |
Q |
| |
|
| |||||||||||||||||||| || ||||||||||||||||| || | |||||||||||||| |
|
|
| T |
38242471 |
attgaacctggtttaggataacatgtggacattcctacaatgtatcccacttcatttcctgcttc |
38242535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 20225176 - 20225212
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20225176 |
catatgcgggagctttagtgcaccgggttgcccttta |
20225212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 11394954 - 11394989
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctttaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11394954 |
tatgcgggagctttagtgcaccgggttgccctttaa |
11394989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 11404681 - 11404716
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctttaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11404681 |
tatgcgggagctttagtgcaccgggttgccctttaa |
11404716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 16408636 - 16408601
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16408636 |
catatgcgggagctttagtgcaccgggttgcccttt |
16408601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 23501889 - 23501924
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
23501889 |
catatgcgggagctttagtgcaccgggttgcccttt |
23501924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 25629149 - 25629184
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25629149 |
catatgcgggagctttagtgcaccgggttgcccttt |
25629184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 32484333 - 32484368
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32484333 |
catatgcgggagctttagtgcaccgggttgcccttt |
32484368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 53
Target Start/End: Complemental strand, 38755941 - 38755906
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctttaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38755941 |
tatgcgggagctttagtgcaccgggttgccctttaa |
38755906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 53
Target Start/End: Complemental strand, 40553970 - 40553935
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctttaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40553970 |
tatgcgggagctttagtgcaccgggttgccctttaa |
40553935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 8473655 - 8473621
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8473655 |
catatgcgggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 64 - 127
Target Start/End: Original strand, 38213103 - 38213168
Alignment:
| Q |
64 |
cttgtatttattcctcat--atcgatcatatattgctttgataccatcgatgaaactccacttata |
127 |
Q |
| |
|
|||||||||||||||| | ||| |||||||||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
38213103 |
cttgtatttattcctctttgatcaatcatatattactttgacaccatccatgaaactccacttata |
38213168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 44363163 - 44363129
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44363163 |
tatgcgggagctttagtgcaccgggttgcccttta |
44363129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Original strand, 56323001 - 56323035
Alignment:
| Q |
17 |
atatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
56323001 |
atatgcgggagctttagtgcaccgggttgcccttt |
56323035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 20639691 - 20639658
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20639691 |
tatgcgggagctttagtgcaccgggttgcccttt |
20639658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 35532094 - 35532127
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35532094 |
tatgcgggagctttagtgcaccgggttgcccttt |
35532127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 38242315 - 38242371
Alignment:
| Q |
184 |
actaatcatctaaaagtatattatttaatccataaaaaatgaagaactagtggaatgt |
241 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
38242315 |
actaattatctaaaagtatattattt-gtccataaaaaatgaagaacgagtagaatgt |
38242371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 48
Target Start/End: Original strand, 21647066 - 21647098
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21647066 |
catatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 11054183 - 11054148
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11054183 |
catatgcgggagctctagtgcaccgggttgcccttt |
11054148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 20 - 51
Target Start/End: Complemental strand, 13256430 - 13256399
Alignment:
| Q |
20 |
tgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13256430 |
tgcgggagctttagtgcaccgggttgcccttt |
13256399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 20225082 - 20225117
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20225082 |
catatgcgggagctctagtgcaccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 30639479 - 30639514
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30639479 |
catatgcgggagctttagtgcactgggttgcccttt |
30639514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 38786709 - 38786744
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38786709 |
catatgcgggagctctagtgcaccgggttgcccttt |
38786744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 54175165 - 54175200
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54175165 |
catatgcgggagctttagtgcaccgggctgcccttt |
54175200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 19028013 - 19028046
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
19028013 |
tatgcgggagctttagtgcaccgggctgcccttt |
19028046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 29207933 - 29207900
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccct |
49 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
29207933 |
catatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 30352613 - 30352580
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
30352613 |
tatgcgggagctttagtgcaccgtgttgcccttt |
30352580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 33836520 - 33836487
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
33836520 |
tatgcgggagctttagtgcaacgggttgcccttt |
33836487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 36816417 - 36816384
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
36816417 |
tatgcgggagctttagtgtaccgggttgcccttt |
36816384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 86 - 127
Target Start/End: Original strand, 38237033 - 38237074
Alignment:
| Q |
86 |
atcatatattgctttgataccatcgatgaaactccacttata |
127 |
Q |
| |
|
|||||||||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
38237033 |
atcatatattactttgacaccatccatgaaactccacttata |
38237074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 6430659 - 6430627
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
6430659 |
tatgcgggagctttagcgcaccgggttgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 3e-21; HSPs: 27)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 333 - 429
Target Start/End: Complemental strand, 11463422 - 11463326
Alignment:
| Q |
333 |
ctagagttaaaatttcaccatcatttatcttgacagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctcatttcctgcttc |
429 |
Q |
| |
|
|||| |||||||||||||||||| || ||||| ||||||||||||||| |||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
11463422 |
ctagtgttaaaatttcaccatcaaataacttgatagaacctggtttagggtaacaagttgacattcctacaacataccctttctcatttcctgcttc |
11463326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 265 - 428
Target Start/End: Complemental strand, 11475383 - 11475220
Alignment:
| Q |
265 |
ttctgccaccaataggtagaaaagtcccattactccagtgtgctctttggtgttgttgtagttagattctagagttaaaatttcaccatcatttatcttg |
364 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| ||| | || || | |||||||| |||| |||||| | ||||||||| ||||||| |
|
|
| T |
11475383 |
ttctgccaccaagaaatagaaaagtcccattactccagagtgacttatgttgctactgtagttactctctaatgttaaagtctcaccatcaaatatcttg |
11475284 |
T |
 |
| Q |
365 |
acagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctcatttcctgctt |
428 |
Q |
| |
|
| ||||||||||||||| ||||| || |||||||||||||| |||||| |||||||||||||| |
|
|
| T |
11475283 |
atagaacctggtttagggtaacatgttgacattcctacaatataccctttctcatttcctgctt |
11475220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 260 - 426
Target Start/End: Complemental strand, 11480799 - 11480633
Alignment:
| Q |
260 |
agttcttctgccaccaataggtagaaaagtcccattactccagtgtgctctt-tggtgttgttgtagttagattctagagttaaaatttcaccatcattt |
358 |
Q |
| |
|
|||| |||||||||||| | |||||||| ||||| ||||||| || |||| || || || ||| ||||| |||| ||||||||||||||||||| | |
|
|
| T |
11480799 |
agtttttctgccaccaagaaatagaaaagccccatcactccagagta-tcttatgttgctgctgtggttagcctctaaagttaaaatttcaccatcaaat |
11480701 |
T |
 |
| Q |
359 |
atcttgacagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctcatttcctgc |
426 |
Q |
| |
|
||||||| |||||||||| |||| |||||||| ||||||||||||| |||||| ||||| |||||| |
|
|
| T |
11480700 |
atcttgatagaacctggtatagggtaacaagttgacattcctacaacataccctttctcatctcctgc |
11480633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 265 - 427
Target Start/End: Complemental strand, 11486616 - 11486454
Alignment:
| Q |
265 |
ttctgccaccaataggtagaaaagtcccattactccagtgtgctctt-tggtgttgttgtagttagattctagagttaaaatttcaccatcatttatctt |
363 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| ||| |||| || || | ||||||||| |||| |||||| ||||||||||| |||||| |
|
|
| T |
11486616 |
ttctgccaccaagaaatagaaaagtcccattactccagagtg-tcttatgttgctactgtagttagtctctaatgttaaattttcaccatcaaatatctt |
11486518 |
T |
 |
| Q |
364 |
gacagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctcatttcctgct |
427 |
Q |
| |
|
|| ||||||||||||||| ||||| || ||||| ||||||| || ||| ||||||||||||| |
|
|
| T |
11486517 |
gatagaacctggtttagggtaacatgttgacatgcctacaacatatcctttctcatttcctgct |
11486454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 14530422 - 14530456
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14530422 |
tatgcgggagctttagtgcaccgggttgcccttta |
14530456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 9671281 - 9671314
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9671281 |
tatgcgggagctttagtgcaccgggttgcccttt |
9671314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 10543802 - 10543835
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10543802 |
tatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 10546265 - 10546298
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10546265 |
tatgcgggagctttagtgcaccgggttgcccttt |
10546298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 22371214 - 22371247
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
22371214 |
tatgcgggagctttagtgcaccgggttgcccttt |
22371247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 25632611 - 25632644
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25632611 |
tatgcgggagctttagtgcaccgggttgcccttt |
25632644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 36871593 - 36871626
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36871593 |
tatgcgggagctttagtgcaccgggttgcccttt |
36871626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 23397864 - 23397900
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23397864 |
catatgcgggagctctagtgcaccgggttgcccttta |
23397900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 40416906 - 40416870
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40416906 |
catatgcgagagctttagtgcaccgggttgcccttta |
40416870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 40579782 - 40579750
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40579782 |
tatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 3633743 - 3633708
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3633743 |
catatgcgggagctttagtgcaccgagttgcccttt |
3633708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 5841130 - 5841165
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5841130 |
catatgcgggagctttagtgcaccgagttgcccttt |
5841165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 21779296 - 21779261
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21779296 |
catatgcgggagctctagtgcaccgggttgcccttt |
21779261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 34080201 - 34080236
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34080201 |
catatgcgggagttttagtgcaccgggttgcccttt |
34080236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 47
Target Start/End: Complemental strand, 124947 - 124918
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcc |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
124947 |
tatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 8455349 - 8455316
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
8455349 |
tatgccggagctttagtgcaccgggttgcccttt |
8455316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 11514537 - 11514570
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
11514537 |
tatgcgggagctttagtgcaccggattgcccttt |
11514570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 14444830 - 14444863
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
14444830 |
tatgcgggagctttagtgcaccaggttgcccttt |
14444863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 25249771 - 25249738
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
25249771 |
tatgcgtgagctttagtgcaccgggttgcccttt |
25249738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 39914339 - 39914306
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
39914339 |
tatgcgggagctttagtgcatcgggttgcccttt |
39914306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 40762267 - 40762234
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
40762267 |
tatgtgggagctttagtgcaccgggttgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 49
Target Start/End: Original strand, 41409962 - 41409995
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccct |
49 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
41409962 |
catatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 23 - 51
Target Start/End: Original strand, 17668109 - 17668137
Alignment:
| Q |
23 |
gggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17668109 |
gggagctttagtgcaccgggttgcccttt |
17668137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0083
Description:
Target: scaffold0083; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 284 - 434
Target Start/End: Complemental strand, 49184 - 49034
Alignment:
| Q |
284 |
aaaagtcccattactccagtgtgctctt-tggtgttgttgtagttagattctagagttaaaatttcaccatcatttatcttgacagaacctggtttagga |
382 |
Q |
| |
|
||||| ||||||||||||| ||| |||| || ||||||| ||||| |||||||||||| ||||||||| | |||||||| ||||||||||| |||| |
|
|
| T |
49184 |
aaaagccccattactccagagtg-tcttctgctgttgttatagttcacctctagagttaaagtttcaccattaaatatcttgatagaacctggttgagga |
49086 |
T |
 |
| Q |
383 |
taacaagtagacattcctacaatgtaccctgcctcatttcctgcttcttttc |
434 |
Q |
| |
|
|||||||| ||||||||||||| || ||| |||||||||||||| |||| |
|
|
| T |
49085 |
taacaagtggacattcctacaacatatcctttttcatttcctgcttcctttc |
49034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 3e-18; HSPs: 17)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 248 - 434
Target Start/End: Complemental strand, 21548038 - 21547852
Alignment:
| Q |
248 |
tgttggtatggaagttcttctgccaccaataggtagaaaagtcccattactccagtgtgctctt-tggtgttgttgtagttagattctagagttaaaatt |
346 |
Q |
| |
|
||||||| ||| || | |||||||||||| | || ||||| ||||||||||||| ||| |||| || ||||||| ||||| |||||| ||||| || |
|
|
| T |
21548038 |
tgttggtgtggtagcttttctgccaccaagaaataaaaaagccccattactccagagtg-tcttctgctgttgttatagttcacctctagaattaaagtt |
21547940 |
T |
 |
| Q |
347 |
tcaccatcatttatcttgacagaacctggtttaggataacaagtagacattcctacaatgtaccctgcctcatttcctgcttcttttc |
434 |
Q |
| |
|
||||||| | |||||||| ||||||||||| |||||||||||| | ||||||||||| |||||| |||||||||||||| |||| |
|
|
| T |
21547939 |
tcaccattaagtatcttgatagaacctggttgaggataacaagtggtcattcctacaacataccctttttcatttcctgcttcctttc |
21547852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 20004125 - 20004090
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20004125 |
catatgcgggagctttagtgcaccgggttgcccttt |
20004090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 50606526 - 50606561
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50606526 |
catatgcgggagctttagtgcaccgggttgcccttt |
50606561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 4349763 - 4349797
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4349763 |
tatgcgggagctttagtgcaccgggttgcccttta |
4349797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 10668352 - 10668385
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10668352 |
tatgcgggagctttagtgcaccgggttgcccttt |
10668385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 14617161 - 14617196
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14617161 |
catatgcgggagctttagtgcaccgggttacccttt |
14617196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 19414560 - 19414595
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19414560 |
catatgcgggagctctagtgcaccgggttgcccttt |
19414595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 30395761 - 30395726
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30395761 |
catatgcgggagctttagtgcaccgagttgcccttt |
30395726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 34725133 - 34725098
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34725133 |
catatgcgggagctctagtgcaccgggttgcccttt |
34725098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 38478317 - 38478282
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38478317 |
catatgcgggagctctagtgcaccgggttgcccttt |
38478282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 48
Target Start/End: Original strand, 45402221 - 45402251
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45402221 |
tatgcgggagctttagtgcaccgggttgccc |
45402251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 1517344 - 1517311
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
1517344 |
tatgcaggagctttagtgcaccgggttgcccttt |
1517311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 9939589 - 9939622
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
9939589 |
tatgcgggagctttagtgcaccgggttacccttt |
9939622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 27474405 - 27474438
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
27474405 |
tatgcgggagctttagtgcaccggattgcccttt |
27474438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 35005250 - 35005283
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
35005250 |
tatgcgggcgctttagtgcaccgggttgcccttt |
35005283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 46247986 - 46247953
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
46247986 |
tatgcgggagctttagtgtaccgggttgcccttt |
46247953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 10378770 - 10378738
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccc |
48 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
10378770 |
catatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000003; HSPs: 28)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 16 - 53
Target Start/End: Original strand, 39203636 - 39203673
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccctttaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39203636 |
catatgcgggagctttagtgcaccgggttgccctttaa |
39203673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 13730637 - 13730602
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13730637 |
catatgcgggagctttagtgcaccgggttgcccttt |
13730602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 24851336 - 24851301
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24851336 |
catatgcgggagctttagtgcaccgggttgcccttt |
24851301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 353384 - 353351
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccct |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
353384 |
catatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 516536 - 516569
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
516536 |
tatgcgggagctttagtgcaccgggttgcccttt |
516569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 4495709 - 4495676
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4495709 |
tatgcgggagctttagtgcaccgggttgcccttt |
4495676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 5173752 - 5173719
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5173752 |
tatgcgggagctttagtgcaccgggttgcccttt |
5173719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 10484649 - 10484616
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10484649 |
tatgcgggagctttagtgcaccgggttgcccttt |
10484616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 13628823 - 13628790
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13628823 |
tatgcgggagctttagtgcaccgggttgcccttt |
13628790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 40272845 - 40272812
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40272845 |
tatgcgggagctttagtgcaccgggttgcccttt |
40272812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 40390365 - 40390398
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40390365 |
tatgcgggagctttagtgcaccgggttgcccttt |
40390398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 47624223 - 47624256
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47624223 |
tatgcgggagctttagtgcaccgggttgcccttt |
47624256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 54032604 - 54032571
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54032604 |
tatgcgggagctttagtgcaccgggttgcccttt |
54032571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 54484815 - 54484848
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54484815 |
tatgcgggagctttagtgcaccgggttgcccttt |
54484848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 1217210 - 1217245
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1217210 |
catatgcgggagctctagtgcaccgggttgcccttt |
1217245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 14987081 - 14987116
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14987081 |
catatgcgggagctttagtgcaccgggtttcccttt |
14987116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 30452917 - 30452952
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30452917 |
catatgcgggagctctagtgcaccgggttgcccttt |
30452952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 31592969 - 31593004
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31592969 |
catatgcgggagctctagtgcaccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 49013508 - 49013473
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49013508 |
catacgcgggagctttagtgcaccgggttgcccttt |
49013473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 14266405 - 14266372
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
14266405 |
tatgcgggagctttagtgcactgggttgcccttt |
14266372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 23871490 - 23871523
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
23871490 |
tatgcgggaactttagtgcaccgggttgcccttt |
23871523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 25517203 - 25517170
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
25517203 |
tatgctggagctttagtgcaccgggttgcccttt |
25517170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 26869830 - 26869863
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
26869830 |
tatgcgggagctttggtgcaccgggttgcccttt |
26869863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 43956505 - 43956472
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
43956505 |
tatgcgggagctttagtgcaccgggctgcccttt |
43956472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 45786246 - 45786213
Alignment:
| Q |
19 |
atgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
45786246 |
atgctggagctttagtgcaccgggttgcccttta |
45786213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 52926252 - 52926219
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
52926252 |
tatgcgggagctttagcgcaccgggttgcccttt |
52926219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 22609889 - 22609921
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
22609889 |
tatgcgggagcttcagtgcaccgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 31831308 - 31831344
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
31831308 |
catatgcgggtgctctagtgcaccgggttgcccttta |
31831344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 25)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 6760924 - 6760959
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6760924 |
catatgcgggagctttagtgcaccgggttgcccttt |
6760959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 20870025 - 20870060
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20870025 |
catatgcgggagctttagtgcaccgggttgcccttt |
20870060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 10857931 - 10857964
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10857931 |
tatgcgggagctttagtgcaccgggttgcccttt |
10857964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 12625992 - 12626025
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12625992 |
tatgcgggagctttagtgcaccgggttgcccttt |
12626025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 23000260 - 23000227
Alignment:
| Q |
19 |
atgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23000260 |
atgcgggagctttagtgcaccgggttgcccttta |
23000227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 27468125 - 27468092
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27468125 |
tatgcgggagctttagtgcaccgggttgcccttt |
27468092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 35261781 - 35261814
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35261781 |
tatgcgggagctttagtgcaccgggttgcccttt |
35261814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 39461027 - 39460994
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39461027 |
tatgcgggagctttagtgcaccgggttgcccttt |
39460994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 16225121 - 16225157
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16225121 |
catatgcgggagctttagtgcaccgggttgtccttta |
16225157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 17823676 - 17823712
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17823676 |
catatgcaggagctttagtgcaccgggttgcccttta |
17823712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 7136562 - 7136527
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7136562 |
catatgcgggagctttagtgcaccgggttacccttt |
7136527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 25250624 - 25250659
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25250624 |
catatgcgggagatttagtgcaccgggttgcccttt |
25250659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 26954235 - 26954270
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26954235 |
catatgcgggagctttagtgcactgggttgcccttt |
26954270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 30454132 - 30454097
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30454132 |
catatgcgggagctctagtgcaccgggttgcccttt |
30454097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 16013558 - 16013591
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
16013558 |
tatgcgggagctttagtgcaccgggttgtccttt |
16013591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 47
Target Start/End: Complemental strand, 18164793 - 18164764
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcc |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18164793 |
tatgcgggagctttagtgcaccgggttgcc |
18164764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 26102619 - 26102652
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
26102619 |
tatgcgggagctctagtgcaccgggttgcccttt |
26102652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 28407505 - 28407538
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
28407505 |
tatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 28817659 - 28817626
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
28817659 |
tatgcgggagctttagtgcatcgggttgcccttt |
28817626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 29521718 - 29521685
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
29521718 |
tatgcgggagctttagtgcaccgggttgctcttt |
29521685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 35107344 - 35107311
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
35107344 |
tatgcggaagctttagtgcaccgggttgcccttt |
35107311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 44530251 - 44530284
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
44530251 |
tatgcgggagctttagtgcaccgggttgaccttt |
44530284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 23286372 - 23286336
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
23286372 |
catatgcgggagctctagtgcaccgggctgcccttta |
23286336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 27508012 - 27508044
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
27508012 |
tatgcgggagctttagtgcaccgggttgtcctt |
27508044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 45071366 - 45071398
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45071366 |
tatgcgggagcttcagtgcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 17)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 42805626 - 42805661
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42805626 |
catatgcgggagctttagtgcaccgggttgcccttt |
42805661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 36602549 - 36602582
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36602549 |
tatgcgggagctttagtgcaccgggttgcccttt |
36602582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 2541052 - 2541016
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctttaaa |
54 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2541052 |
tatgcgggagctttagtgcaccgggtttccctttaaa |
2541016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 29907520 - 29907552
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29907520 |
tatgcgggagctttagtgcaccgggttgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 47716561 - 47716597
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47716561 |
catatgcgggagctttggtgcaccgggttgcccttta |
47716597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 48735157 - 48735121
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48735157 |
catatgcgggagctctagtgcaccgggttgcccttta |
48735121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 21172044 - 21172009
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21172044 |
catatgcgggagctctagtgcaccgggttgcccttt |
21172009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 31591144 - 31591109
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31591144 |
catatgcgggagctctagtgcaccgggttgcccttt |
31591109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 32758359 - 32758394
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32758359 |
catatgcgggagctctagtgcaccgggttgcccttt |
32758394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 42391135 - 42391100
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42391135 |
catatgcgggagctctagtgcaccgggttgcccttt |
42391100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 20 - 51
Target Start/End: Complemental strand, 44171668 - 44171637
Alignment:
| Q |
20 |
tgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44171668 |
tgcgggagctttagtgcaccgggttgcccttt |
44171637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 16 - 54
Target Start/End: Complemental strand, 10693108 - 10693070
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccctttaaa |
54 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
10693108 |
catatgcgggagctctagtgcactgggttgccctttaaa |
10693070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 7879740 - 7879773
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
7879740 |
tatgcgggagcttcagtgcaccgggttgcccttt |
7879773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 38262229 - 38262196
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
38262229 |
tatgcgggagctttagtgcaccggattgcccttt |
38262196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 45018956 - 45018923
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
45018956 |
tatgcgggagctttagtgcaccaggttgcccttt |
45018923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 14 - 50
Target Start/End: Original strand, 16341377 - 16341413
Alignment:
| Q |
14 |
atcatatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
16341377 |
atcatatgcgggagctttggtgcaccgggctgccctt |
16341413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 18747589 - 18747621
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
18747589 |
tatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 21)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 41014418 - 41014453
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41014418 |
catatgcgggagctttagtgcaccgggttgcccttt |
41014453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 16957416 - 16957449
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16957416 |
tatgcgggagctttagtgcaccgggttgcccttt |
16957449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 32354229 - 32354262
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32354229 |
tatgcgggagctttagtgcaccgggttgcccttt |
32354262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 38879685 - 38879718
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38879685 |
tatgcgggagctttagtgcaccgggttgcccttt |
38879718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 13801802 - 13801766
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13801802 |
catatgcgagagctttagtgcaccgggttgcccttta |
13801766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 29184094 - 29184062
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29184094 |
tatgcgggagctttagtgcaccgggttgccctt |
29184062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 19 - 51
Target Start/End: Original strand, 43334307 - 43334339
Alignment:
| Q |
19 |
atgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43334307 |
atgcgggagctttagtgcaccgggttgcccttt |
43334339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 4619139 - 4619104
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4619139 |
catatgcgagagctttagtgcaccgggttgcccttt |
4619104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 16028659 - 16028624
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16028659 |
catatgcgggagctctagtgcaccgggttgcccttt |
16028624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 32703522 - 32703557
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32703522 |
catatgcgggagctctagtgcaccgggttgcccttt |
32703557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 35710411 - 35710446
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35710411 |
catatgcgggagctctagtgcaccgggttgcccttt |
35710446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 16880680 - 16880646
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16880680 |
tatgcgggagctttagtgcaccgggtttcccttta |
16880646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 30006427 - 30006461
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
30006427 |
tatgcgggagctttagtgcaccgggttgcctttta |
30006461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 16 - 54
Target Start/End: Complemental strand, 30877599 - 30877561
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccctttaaa |
54 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
30877599 |
catatgtgggagctctagtgcaccgggttgccctttaaa |
30877561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 49
Target Start/End: Original strand, 11462925 - 11462958
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgccct |
49 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
11462925 |
catatgcgggagctctagtgcaccgggttgccct |
11462958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 24448992 - 24449025
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
24448992 |
tatgcaggagctttagtgcaccgggttgcccttt |
24449025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 25622562 - 25622595
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
25622562 |
tatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 47
Target Start/End: Original strand, 39801618 - 39801647
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcc |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39801618 |
tatgcgggagctttagtgcaccgggttgcc |
39801647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 19 - 51
Target Start/End: Complemental strand, 10943877 - 10943845
Alignment:
| Q |
19 |
atgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
10943877 |
atgcgggagctttagtgcaccgggctgcccttt |
10943845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 12006361 - 12006329
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgccctt |
50 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
12006361 |
tatgcgggagctttagtgcaccgtgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 34154849 - 34154813
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
34154849 |
catatgcggtagctctagtgcaccgggttgcccttta |
34154813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 46933 - 46966
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46933 |
tatgcgggagctttagtgcaccgggttgcccttt |
46966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 30677 - 30712
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30677 |
catatgcgggagctctagtgcaccgggttgcccttt |
30712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 48669 - 48634
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48669 |
catatgcgggagctctagtgcaccgggttgcccttt |
48634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 59081 - 59115
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
59081 |
tatgcgggagctttagtgcatcgggttgcccttta |
59115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 13057 - 13024
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
13057 |
tatgcgggggctttagtgcaccgggttgcccttt |
13024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 72900 - 72867
Alignment:
| Q |
18 |
tatgcgggagctttagtgcaccgggttgcccttt |
51 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
72900 |
tatgcgggagctttagtgcaccaggttgcccttt |
72867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 11229 - 11265
Alignment:
| Q |
16 |
catatgcgggagctttagtgcaccgggttgcccttta |
52 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
11229 |
catatgcgggagctctagtgcaccaggttgcccttta |
11265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University