View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_79 (Length: 414)
Name: NF13763_low_79
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_79 |
 | |
|
| [»] scaffold0020 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0020 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 19 - 404
Target Start/End: Complemental strand, 10548 - 10169
Alignment:
| Q |
19 |
ataccggattctctacttccttgagcaccaccgtctgtttgactgttattgtttgcaaaatttgacattagagagtatatattattacaaagcaatctca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10548 |
ataccggattctctacttccttgagcaccaccgtctgtttgactgttattgtttgcaaaatttgacattagagagtatatattattacaaagcaatctca |
10449 |
T |
|
| Q |
119 |
tatcagcaagctctttattcaataaatggttctctttccttaatctctcgttttcgtcgagaagctccgctggtgctcgtgctggagaagaactcgatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10448 |
tatcagcaagctctttattcaataaatggttctctttccttaatctctcgttttcgtcgagaagctccgctggtgctcgtgctggagaagaactcgatga |
10349 |
T |
|
| Q |
219 |
tatcacctgttcttcaccggagttagacggtgaaatcatctgcatcaccgttggtattactgtcaacggcataggcgaaggaactgcaaccgtcgctgtt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10348 |
tatcacctgttcttcaccggagttagacggtgaaatcatctgcatcaccgttggtattactgtcaacggcatcggcgaaggaactgcaaccgtcgctgtt |
10249 |
T |
|
| Q |
319 |
gtagtttctgctgctattgtagaagcagaaacagaaacagacacagacgacggtgaaggtgttggagaacagatctttctcctttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10248 |
gtagtttctgctgctattgtagaagcagaaacagaaac------agacgacggtgaaggtgttggagaacagatcttcctcctttg |
10169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University