View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13763_low_87 (Length: 407)
Name: NF13763_low_87
Description: NF13763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13763_low_87 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 191 - 389
Target Start/End: Original strand, 11296287 - 11296484
Alignment:
| Q |
191 |
tacaatcttcttttgatcattcattatttactaagaaattcggtaattctttcgtagccattttaatttatgttgatgatgttatcattgcaggtaacaa |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
11296287 |
tacaatcttcttttgatcattcattatttactaagaaatttggtaattctttcgtagccattttaatttatgttgatgatattattattgcaggtaacaa |
11296386 |
T |
 |
| Q |
291 |
tcttcaagaaagtacatatatcaaggcctttctcaacaacaatttcaaaatcaaggatcctggaagattgaagtattttttggggattgaagtagcttg |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
11296387 |
tcttcaagaaagtacatatatcaaggccttcctcaaaaacaatttcaaaatcaaggatcttggaacattg-agtatttttttgggattgaagtagcttg |
11296484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 13 - 77
Target Start/End: Original strand, 11296079 - 11296143
Alignment:
| Q |
13 |
aatatccaggttaatttgttgccaggaaactagagatgtatgtaaatgaagtagaaaaaggaaca |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11296079 |
aatatccaggttaatttgttgccaggaaactagagatgtatgtaaatgaagtagaaaaaggaaca |
11296143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University