View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_high_20 (Length: 394)
Name: NF13764_high_20
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 17 - 378
Target Start/End: Original strand, 20190263 - 20190622
Alignment:
| Q |
17 |
cacagagaaaaagggtttcaaaaaa-gtgannnnnnngggttaacaatgatccaatggacgaatcggttgaatgctgcatttgggttttcatttctttgg |
115 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20190263 |
cacagagaaatagggtttcaaaaaaagtgaaatttgtgggttaacaatgatccaatggacgaatcggctgaatgctgcatttgggttttcatttctttgg |
20190362 |
T |
 |
| Q |
116 |
ttaatttgcttgatttacttcacccaggttccacttcttcattttttatcaannnnnnngataaatattaaatctttgtgtgaaattattgatgggtttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
20190363 |
ttaatttgcttgatttacttcacccaggtttcacttcttcatcttttgtcaatttttttgataaatattaaatctttgtgtgaaattattgatgggcttt |
20190462 |
T |
 |
| Q |
216 |
tgtttttctttgagatctggtagttttatttattgggtgttgttgtttaattcatgcttttagtcccattttaatttttatattcaaagttgctatgaat |
315 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20190463 |
tgtttttctttgagatctgatagttttatttattggg---tgttgtttaattcatgtttttagtcccattttaatttttatattcaaagttgctatgaat |
20190559 |
T |
 |
| Q |
316 |
gaagnnnnnnngttgtgttattctttattttttagtaaattttatgattctatgtgttgatct |
378 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20190560 |
gaagtttttttgttgtgttattctttattttttagtaaattttatgattctatgtgttgatct |
20190622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University