View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_high_26 (Length: 354)
Name: NF13764_high_26
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_high_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 264
Target Start/End: Complemental strand, 38101105 - 38100850
Alignment:
| Q |
10 |
aagaatatatagaagcaagtgattcataattc-tcacaatttcaagttcttaacactattatatttatgggcagatggcaacattggcttcttattttgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38101105 |
aagaatatatagaagcaagtgattcataattcctcacaatttcaagttcttaacactattatatttatgggcagatggcaacattggcttcttattttgg |
38101006 |
T |
|
| Q |
109 |
cttggggcaacaaaaacacaggtatcgttgcgtttcgataaacaatttaattaagaatctaataaataattaagttcttatcgtataacaacgctatgaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38101005 |
cttggggcaacaaaaacacaggtatcgttgcgtttcgataaacaatttaattaagaatctaataaataattaagttcttatcgtataacaacgctatgaa |
38100906 |
T |
|
| Q |
209 |
tgaacttattaaacaagtacttataaaaataaatcgaggaaggagaaaattattac |
264 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38100905 |
tgaactttttaaacaagtacttataaaaataaatcgaggaaggagaaaattattac |
38100850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 288 - 336
Target Start/End: Complemental strand, 38100831 - 38100783
Alignment:
| Q |
288 |
tcatgcttatagccaattttacaaccaaattgaaggggatttgaactct |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38100831 |
tcatgcttatagccaattttacaaccaaattgaaggggatttgaactct |
38100783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University