View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_high_38 (Length: 299)
Name: NF13764_high_38
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_high_38 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 43537335 - 43537028
Alignment:
| Q |
1 |
attagtggggtggcatggaggatggaaaaagtggagtatggagaacgaaatcggaacaactagagtcagtgat------------gtccacaccgggatc |
88 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
43537335 |
attagtgaggtggcatggaggatggaaaaagtggattatggagaacgaaatcggaacaactagagtcagtggtagaagatttgacgtccacaccgggatc |
43537236 |
T |
 |
| Q |
89 |
aagtgagtcggtcggagtggcggacggtggtagtgggagtcttacaagaaaatcaaggagggcatcccccggtggaagaaatacacacataaggaaggcg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537235 |
aagtgagtcggtcggagtggcggacggtggtagtgggagtcttactagaaaatcaaggagggcatcccccggtggaagaaatacacacataaggaaggcg |
43537136 |
T |
 |
| Q |
189 |
aggagtgtccagacttctttgaaggttgatttggatcatgaggttaatagtggtgctgctcttagtagagcttcaagtttgggactctcattttccttta |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537135 |
aggagtgtccagacttctttgaaggttgatttgg---atgaggttaatagtggtgctgctcttagtagagcttcaagtttgggactctcattttccttta |
43537039 |
T |
 |
| Q |
289 |
ctggattctct |
299 |
Q |
| |
|
||||||||||| |
|
|
| T |
43537038 |
ctggattctct |
43537028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University