View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13764_high_53 (Length: 253)

Name: NF13764_high_53
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13764_high_53
NF13764_high_53
[»] chr8 (6 HSPs)
chr8 (1-77)||(13522337-13522413)
chr8 (1-77)||(13611872-13611948)
chr8 (198-235)||(13522159-13522196)
chr8 (198-235)||(13611694-13611731)
chr8 (91-119)||(13522275-13522303)
chr8 (91-119)||(13611810-13611838)


Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 13522413 - 13522337
Alignment:
Q  1 tttattgattgagcaagaatttttagttgaggttcaactaatgtcatcgagtgtgattcccttttgattaacgatga 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  13522413 tttattgattgagcaagaatttttagttgaggttcaactaatgtcatcgagtgtgattcccttttgattaacaatga 13522337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 13611948 - 13611872
Alignment:
Q  1 tttattgattgagcaagaatttttagttgaggttcaactaatgtcatcgagtgtgattcccttttgattaacgatga 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  13611948 tttattgattgagcaagaatttttagttgaggttcaactaatgtcatcgagtgtgattcccttttgattaacaatga 13611872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 198 - 235
Target Start/End: Complemental strand, 13522196 - 13522159
Alignment:
Q  198 tttgttttattggttgactctcttatttagagtgtaca 235  Q
    ||||||||||||||||||||||||||||||||||||||    
T  13522196 tttgttttattggttgactctcttatttagagtgtaca 13522159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 198 - 235
Target Start/End: Complemental strand, 13611731 - 13611694
Alignment:
Q  198 tttgttttattggttgactctcttatttagagtgtaca 235  Q
    ||||||||||||||||||||||||||||||||||||||    
T  13611731 tttgttttattggttgactctcttatttagagtgtaca 13611694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 119
Target Start/End: Complemental strand, 13522303 - 13522275
Alignment:
Q  91 taatttctctagcaaagcattatgtacgg 119  Q
    |||||||||||||||||||||||||||||    
T  13522303 taatttctctagcaaagcattatgtacgg 13522275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 119
Target Start/End: Complemental strand, 13611838 - 13611810
Alignment:
Q  91 taatttctctagcaaagcattatgtacgg 119  Q
    |||||||||||||||||||||||||||||    
T  13611838 taatttctctagcaaagcattatgtacgg 13611810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University