View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_high_61 (Length: 231)
Name: NF13764_high_61
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_high_61 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 211
Target Start/End: Original strand, 1455348 - 1455544
Alignment:
| Q |
15 |
gatgaacatttacaaccggactcaacggttgctttctcctttgatttttgttgttgaaattcattgcaattcactttcactaagttttgataagatgctt |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1455348 |
gatgaacatttacgaccggactcaacggttgctttctccttcgatttttgttgttgaaattcattgcaattcactttcactaagttttgataagatgctt |
1455447 |
T |
|
| Q |
115 |
ggttagaatcaactgggatcgcgtctttcttcttagccttcttcttttcatcgttgtcacggccttcaaagggagaacttctcttctttggaacggt |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1455448 |
ggttagaatcaactgcgatcgcgtctttcttcttcgccttcttcttttcatcgttgtcacggccttcaaagggagaacttctcttctttggaacggt |
1455544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 105
Target Start/End: Original strand, 1451709 - 1451754
Alignment:
| Q |
60 |
ttttgttgttgaaattcattgcaattcactttcactaagttttgat |
105 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||| ||||||||| |
|
|
| T |
1451709 |
ttttgttgttggaattcattacacttcactttcactgagttttgat |
1451754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University