View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_high_65 (Length: 213)
Name: NF13764_high_65
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_high_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 82 - 195
Target Start/End: Complemental strand, 25027357 - 25027245
Alignment:
| Q |
82 |
gccaacatattgagagttttgaacattttgggaattctgaattctcacttctcattcattttgaacaaaacaaagagtgaatcagcttgttgctacttca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25027357 |
gccaacatattgagagttttgaacattttgggaattctgaattctcacttctcattcattttgaacaaaacaaag-gtgaatcagcttgttgctacttca |
25027259 |
T |
 |
| Q |
182 |
accatgtgatccct |
195 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25027258 |
accatgtgatccct |
25027245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 15 - 90
Target Start/End: Complemental strand, 25031964 - 25031889
Alignment:
| Q |
15 |
cagagagggatgggactggaaccaatcagtacgtatttttggagggaagtgataatgtgataaccatgccaacata |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031964 |
cagagagggatgggactggaaccaatcagtacgtatttttggagggaagtgataatgtgataaccatgccaacata |
25031889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University