View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_low_48 (Length: 267)
Name: NF13764_low_48
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_low_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 8 - 185
Target Start/End: Complemental strand, 10141517 - 10141340
Alignment:
| Q |
8 |
cgaagaatattacctccgatcttatatatatatgagacatttgcgcatttgtcgaataaaaaggagacattttagtaagattgtgcatttgacgttaaat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
10141517 |
cgaaaaatattacctccgatcttatatatatatgagacatttgcgcatttgtcgaacaaaaaggaaacattttagtaagatagtgcatttgacgttaaat |
10141418 |
T |
 |
| Q |
108 |
ttaaactaaatacatcaaattttattgactcgattgtctcttatatagccatacttgataaagattatgagctcatac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10141417 |
ttaaactaaatacatcaaattttattgactcaattgtttcttatatagccatacttgataaagattatgagctcatac |
10141340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 151
Target Start/End: Complemental strand, 23523006 - 23522958
Alignment:
| Q |
103 |
taaatttaaactaaatacatcaaattttattgactcgattgtctcttat |
151 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
23523006 |
taaatttaaagtaaatacatcaaattttattgactaaattttctcttat |
23522958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University