View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_low_49 (Length: 267)
Name: NF13764_low_49
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 7995994 - 7995805
Alignment:
| Q |
19 |
tgaacatgattatgtgttctttcaattttcatgtttacacattttgtgtgatcgaaattctgttgtattaggaacgtggaaagaaacgtggtaaagtcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7995994 |
tgaacatgattatgtgttctttcaatttgcatgtttacgcattttgtgtgatcgatattattttgtattaggaacgtggaaagaaacgtggtaaagtcca |
7995895 |
T |
 |
| Q |
119 |
atcaaataagaaacagaagttgagcaaaactcagaaaaagaagttgaagaaatcagaggtttgtgggggtgtggacaaaaaaggatatga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7995894 |
atcaaataagaaacagaagttgagcaaaactcagaaaaagaagttgaagaaatcagaggtttgtgggggtgtggacaaaaaaggatatga |
7995805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University