View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_low_55 (Length: 252)
Name: NF13764_low_55
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 3651310 - 3651459
Alignment:
| Q |
1 |
tttctagtgattattttgaatcatatttttaattactgaattcgtaacttaaaatcacacaaattaactttgatatgtagagcaaaataaaatgaaatag |
100 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3651310 |
tttctaatgactattttgaatcatatttttcattactgaattcgtaacttaaaatcgcacaaattaactttgatatgtagagc-----aaaatgaaatag |
3651404 |
T |
 |
| Q |
101 |
taatcaaatcaaaggagcttcaagcaagaagaacaacatacctatatctaagtgt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3651405 |
taatcaaatcaaaggagcttcaagcaagaagaacaacatacctaaatctaagtgt |
3651459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 3677748 - 3677700
Alignment:
| Q |
107 |
aatcaaaggagcttcaagcaagaagaacaacatacctatatctaagtgt |
155 |
Q |
| |
|
|||||||| |||||||||||| || ||||| | |||||||||||||||| |
|
|
| T |
3677748 |
aatcaaagtagcttcaagcaacaacaacaatagacctatatctaagtgt |
3677700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University