View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13764_low_55 (Length: 252)

Name: NF13764_low_55
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13764_low_55
NF13764_low_55
[»] chr5 (1 HSPs)
chr5 (1-155)||(3651310-3651459)
[»] chr4 (1 HSPs)
chr4 (107-155)||(3677700-3677748)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 3651310 - 3651459
Alignment:
1 tttctagtgattattttgaatcatatttttaattactgaattcgtaacttaaaatcacacaaattaactttgatatgtagagcaaaataaaatgaaatag 100  Q
    |||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||     ||||||||||||    
3651310 tttctaatgactattttgaatcatatttttcattactgaattcgtaacttaaaatcgcacaaattaactttgatatgtagagc-----aaaatgaaatag 3651404  T
101 taatcaaatcaaaggagcttcaagcaagaagaacaacatacctatatctaagtgt 155  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
3651405 taatcaaatcaaaggagcttcaagcaagaagaacaacatacctaaatctaagtgt 3651459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 3677748 - 3677700
Alignment:
107 aatcaaaggagcttcaagcaagaagaacaacatacctatatctaagtgt 155  Q
    |||||||| |||||||||||| || ||||| | ||||||||||||||||    
3677748 aatcaaagtagcttcaagcaacaacaacaatagacctatatctaagtgt 3677700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University