View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13764_low_62 (Length: 231)

Name: NF13764_low_62
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13764_low_62
NF13764_low_62
[»] chr5 (2 HSPs)
chr5 (15-211)||(1455348-1455544)
chr5 (60-105)||(1451709-1451754)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 211
Target Start/End: Original strand, 1455348 - 1455544
Alignment:
15 gatgaacatttacaaccggactcaacggttgctttctcctttgatttttgttgttgaaattcattgcaattcactttcactaagttttgataagatgctt 114  Q
    ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1455348 gatgaacatttacgaccggactcaacggttgctttctccttcgatttttgttgttgaaattcattgcaattcactttcactaagttttgataagatgctt 1455447  T
115 ggttagaatcaactgggatcgcgtctttcttcttagccttcttcttttcatcgttgtcacggccttcaaagggagaacttctcttctttggaacggt 211  Q
    ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1455448 ggttagaatcaactgcgatcgcgtctttcttcttcgccttcttcttttcatcgttgtcacggccttcaaagggagaacttctcttctttggaacggt 1455544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 105
Target Start/End: Original strand, 1451709 - 1451754
Alignment:
60 ttttgttgttgaaattcattgcaattcactttcactaagttttgat 105  Q
    ||||||||||| |||||||| || |||||||||||| |||||||||    
1451709 ttttgttgttggaattcattacacttcactttcactgagttttgat 1451754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University