View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_low_63 (Length: 227)
Name: NF13764_low_63
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_low_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 7227262 - 7227484
Alignment:
| Q |
1 |
attgttcgtgatgaacaaaaactttccatatcaagtgccacactcacctatttaacaatactaaatctttgggttggtttcaaatttgaattatccactc |
100 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7227262 |
attgttagtaatgaacaaaaactttccatatcaagtgccacactcacctatttaacaatactaaatctttgtgttggtttcaaatttgaattatccactc |
7227361 |
T |
 |
| Q |
101 |
caagtctttctaattttgttgtttattgtggtgctcctcttcagaaattgtgtgggagcacgtgcaatctcccttccattaaacatgtaaatatcatcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7227362 |
caagtctttctaattttgttgtttattgtggtgcttctcttcagaaattgtgtgggagcacgtgcaatctcccttccatcaaacatgtaaatatcatcat |
7227461 |
T |
 |
| Q |
201 |
tcatggaagaagggagctgaatt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7227462 |
tcatggaagaagggagctgaatt |
7227484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 60
Target Start/End: Complemental strand, 7140282 - 7140236
Alignment:
| Q |
14 |
aacaaaaactttccatatcaagtgccacactcacctatttaacaata |
60 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
7140282 |
aacaaaacctttgcatatcaagtgccacgctcaccaatttaacaata |
7140236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 60
Target Start/End: Complemental strand, 8656197 - 8656151
Alignment:
| Q |
14 |
aacaaaaactttccatatcaagtgccacactcacctatttaacaata |
60 |
Q |
| |
|
||||||| || | |||||||||||||||||||||| ||||||||||| |
|
|
| T |
8656197 |
aacaaaacctctgcatatcaagtgccacactcaccaatttaacaata |
8656151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University