View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13764_low_64 (Length: 222)
Name: NF13764_low_64
Description: NF13764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13764_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 34516849 - 34516654
Alignment:
| Q |
16 |
atattcacacaaatacatgaagaagaaaaaactaatcattaaatttgaaaacaccagcaattcttaaacacattttcataccatataatcagtgagtttt |
115 |
Q |
| |
|
||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
34516849 |
atattcacacaaataaatgaagaataaaaaaataatcattaaatttgaaaacaccagcaatttttaaacacattttcataccatatcatcaatgagtttt |
34516750 |
T |
|
| Q |
116 |
tctttttcacggtaaagtaagattcttatttcttaatgatagaattccatacataaatttaaagtgtaagtgtatcttgtaactcccctttgctac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
34516749 |
tctttttcacggtaaagtaagattcttatttcttaatgatagaattccatacataaatttaaagtgtaagtgtatcttataactccccttagctac |
34516654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University