View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13766_high_3 (Length: 477)
Name: NF13766_high_3
Description: NF13766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13766_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 450; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 450; E-Value: 0
Query Start/End: Original strand, 1 - 462
Target Start/End: Original strand, 45224067 - 45224528
Alignment:
| Q |
1 |
acagttgctgctatttcgagagtttcgacggtagagagtgggaagaataatttacttgcggagggtttgttgttgttgaatcatttggttagggttttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45224067 |
acagttgctgctatttcgagagtttcgacggtggagagtgggaagaataatttacttgcggagggtttgttgttgttgaatcatttggttagggttttgg |
45224166 |
T |
|
| Q |
101 |
attcgggaagtggtttagcgatagagaaagcttgtattgcgcttcaggcgttgagtttgagtagagataatgctagagcgattggatctagaggtggaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45224167 |
attcgggaagtggtttagcgatagagaaagcttgtattgcgcttcaggcgttgagtttgagtagagataatgctagagcgattggatctagaggtggaat |
45224266 |
T |
|
| Q |
201 |
ttcgtctctgttagggatttgtcaaggtggaacgccaggttcgcaaggttatgcggccgcggttttgaggaatctggcaaaatttaatgaaattaaggag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45224267 |
ttcgtctctgttagggatttgtcaaggtggaacgccaggttcgcaaggttatgcggccgcggttttgaggaatctggcaaaatttaatgaaattaaggag |
45224366 |
T |
|
| Q |
301 |
aattttgtggaggagaatgcggttattgttttgttagggctggcttcgtctggaacggggttggcgcgagagaatgccattggttgtgtggcgaatttga |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45224367 |
aattttgtggaggagaatgcggttattgttttgttagggctggcttcgtctgggacggggttggcgcgagagaatgccattggttgtgtggcgaatttga |
45224466 |
T |
|
| Q |
401 |
tttcggaggatgagagtatgagggttttggctgtgaaggaaggtggtgttgagtgtttgaag |
462 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45224467 |
tttcggaggatgagagtatgagggttttggctgtgaaggaaggtggtgtcgagtgtttgaag |
45224528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University