View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13766_high_5 (Length: 366)
Name: NF13766_high_5
Description: NF13766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13766_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 22 - 349
Target Start/End: Complemental strand, 5396288 - 5395961
Alignment:
| Q |
22 |
aacaccaccaaaacttgaatacataacacgtggcaaacaacggatcaaggccggcttaggaactcgtcgaccgtggaaaaccatgtttgatatccggtca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5396288 |
aacaccaccaaaacttgaatacataacacgtggcaaacaacggatcaaggccggcttaggaactcgtcgaccgtggaaaaccatgttcgatatccggtca |
5396189 |
T |
 |
| Q |
122 |
ctcggcatccccactggtgtaccggaagcaatttcacgtgttcgtgtcaacatctcatacttccgcatgaactacactatggtgatgcttttgattttgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396188 |
ctcggcatccccactggtgtaccggaagcaatttcacgtgttcgtgtcaacatctcatacttccgcatgaactacactatggtgatgcttttgattttgt |
5396089 |
T |
 |
| Q |
222 |
ttctgagccttttatggcatccttactcactcattgttttcgttatcctaatggcggcatggttgttcttctacttcctccgtgatcagccggtgatttt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396088 |
ttctgagccttttatggcatccttactcactcattgttttcgttatcctaatggcggcatggttgttcttctacttcctccgtgatcagccggtgatttt |
5395989 |
T |
 |
| Q |
322 |
atggggtcggcttgttgatgatcgaatt |
349 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5395988 |
atggggtcggcttgttgatgatcgaatt |
5395961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University