View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13766_low_10 (Length: 243)
Name: NF13766_low_10
Description: NF13766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13766_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 16 - 170
Target Start/End: Complemental strand, 4310813 - 4310650
Alignment:
| Q |
16 |
cattttagtggttgcaacttgcatcacattcattaattgaataatgatttgttttggtttttgggtagtcccatatcagcacgttttatttattttattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4310813 |
cattttagtggttgcaacttgcatcacattaattaattgaataatgacttgttttggtttttgggtagtcccatatcagcacgttttatttattttattt |
4310714 |
T |
 |
| Q |
116 |
gcctaga--------tcaagttacttgggcaaagct-aaaggttatcccttctttccttttcat |
170 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4310713 |
gcctagatcaaatgatcaagttacttgggcaaagctaaaaggttatcccttctttccttttcat |
4310650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 42 - 170
Target Start/End: Complemental strand, 4305473 - 4305344
Alignment:
| Q |
42 |
cattcatt-aattgaataatgatttgttttggtttttgggtag-----tcccatatcagcacgttttatttattttatttgcctagatcaagttacttgg |
135 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
4305473 |
cattcattgaattgaataatgacttgttttgcttttt-ggtagtcccatcccatatcagcacgttttatttattttatttgcctagatca----ctttcg |
4305379 |
T |
 |
| Q |
136 |
gcaaagctaaaggttatcccttctttccttttcat |
170 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
4305378 |
aaaaagataaaggttatcccttctttccttttcat |
4305344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 233
Target Start/End: Complemental strand, 4310549 - 4310503
Alignment:
| Q |
187 |
aaaacgaccttatttatttatctttaaaagtgaaatttagtcactat |
233 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4310549 |
aaaacggctttatttatttatctttaaaggtgaaatttagtcactat |
4310503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University