View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13766_low_12 (Length: 238)
Name: NF13766_low_12
Description: NF13766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13766_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 32039712 - 32039499
Alignment:
| Q |
8 |
ttctttgcaatgagaaagccatttgtgttcgagtttggagaagatttctagtgtgactttagtgagatccatttttagtgagtttcacaatgaaagttag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32039712 |
ttctttgcaatgagaaagccatttgtgttcgagtttggagaagatgtctagtgtgactttagtgagatccatttttagtgagtttcacaatgaaaattag |
32039613 |
T |
 |
| Q |
108 |
aatatatgaagttatgaatgaatatagttgcaggtgtgttgtagtaatggtgaagagtgtgaaaaaaggagtggaaggtgagaaaggaaagagtgtgtca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32039612 |
aatatatgaagttatgaatgaatatagttgcaggtgtgttgtagtaatggtgaagagtgtgaaaaaaggagtggaaggtgagaaaggaaagagtgtgtca |
32039513 |
T |
 |
| Q |
208 |
cggtttggtgatga |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32039512 |
cggtttggtgatga |
32039499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University